Summary
Transcript IDgene_000018848
Gene IDTTHERM_00637670
Length517 bp
Sequence
AAGAAGAAAAAGAAAAATCTTTAAATTACATAAAAAAAATTATTAAAAGGTATAAAAAAGATAAGTAAAAATGGCTCGTTTGTGGTGGACATTAGACCCTTCTAAATACTACTTAAAGCAAATTTCTTCTGGTGGCAGAAATGAAATTTTATTCACTGTCCTTGGTGTTACCGCTGCTTACTGGTATTTTGGAAATAAAAGATGTGAACATTATTGGAGAAGATAAATCGATAACTGCCAATCATGGAGCAGAGCATAAAATATTAACGGCAACAATTTAACTGTTAAGCAATACTTCTGAAAAGTTTCAGCAATATTAATGAAGCATAAACAATATTTTTAATAAGAATAAAAGTATGAATCACTAATAGATATAAGTTTTTATATAACTAAATAAGGCATATAACAGCTTTTAATAAGAAGAGTGAATACATCTATGAGAAATATGTATGATAGATTTATCTTATGATTCTATTTGTGTATACTTCTTATAACTTTTTACTAATTTACATTCCAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-113,520.9 L-214,304.3 L-315,208.3 S-010,707.0 S-34,961.1
S-63,782.2 S-93,778.8 S-123,273.6 S-153,979.2 S-241,948.7
C-01,162.3 C-21,371.2 C-41,307.8 C-61,243.2 C-81,460.1
C-103,005.9 C-122,587.7 C-142,016.3 C-161,836.6 C-181,812.5