Summary
Transcript IDgene_000018873
Gene IDTTHERM_00644610
Length809 bp
Sequence
AGATTAGTTTAAAATAAATCTCATATAGCAAATATGGTATAAGAATTTTGCATCAAAACTAAATACCAAGCAAATTATAGTACTGCTTCAGTTAGAGCAACAAAGATAATGAGCCATAGTAAAATTAAGATTCAGCATAAACTAACAAAAATTTAAGTTATGTTGATGAGTTGAAGTAAAAAACTAAAAATTAATTGATACAAATCAAAATGCAACAAATTGCTGAATCTCAAAAAACTAAAAAGGAATATCGTGATGCAGTCTTATTTGAAGAAATTTTGAATACTTAAAAAATTATTCCCTTGTATGATTGCTATGGAAAAGTATTTAGACATGAATTGATAAAAAATTTAATTTTTGTTTTGGGTGGCTTTGGAATTTTGTACTATTTCTACAATGATCCTGACTCTAAGCCTAAAAAGAAAACTTTCCTTTGTGCTTTAACTTTGTCTTTTATTGCAACTAGAGTTCTCACTTATCGCCGTTTATAAAAGAGTTTTGTTGATAAGATTATTTATGATACTACAACTTAAATGGTCACCTTGACAAAAAGGACTTTTTATGGTAAAAGATTTGACCAAGAACTAAACCCTGCTTTACTCTTATTTACAAATGACAAATCTTTGAATATGAGAAATATTAATTATATAAATATGGAAACATTAGAAACTTATCAAATTGGATACGATTACGCTTGGAAAAACAAGGCCCTATTTTCTCACATCCTAGAATAAAGAATAGAAACTATCAGAAATAAAAAAAATTGATTTTAATTCTTGTAATTATAATTAAAGCTATTGTAACAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,839.6 L-21,660.5 L-31,307.2 S-0189.3 S-342.8
S-651.4 S-951.5 S-1251.2 S-1575.2 S-2486.1
C-0103.9 C-248.9 C-444.6 C-637.8 C-8101.9
C-1072.2 C-1261.1 C-14108.3 C-1669.9 C-1879.2