Summary
Transcript IDgene_000018925
Gene IDTTHERM_00656140
Length660 bp
Sequence
AAAAAATATCAAGACTACTTACTTATTTTCAAATTGTAAATCAAATAGATAAATGGAAGACTTGAATTAAAAAAAGGAGTAGCAAAATAAAGATTAGCTGAATTTATAAAAGCAAGAAGAAAGAGAGTCTGCTTTTAAGAAGCTTTACAAGGATTATGTCAATTAAAAATAGAATGAAATCAATTTATACAACATATTTAAGAATAATGTATTATTGGAAGATTTTACATATTCTAGAAGGTCCGCGCTAGCATTCATATTTGTTCCTACTTTATTGAATTTATATTATATTTGGAAACCCTATAGCCCTATGAAGAATACCTTCAGAATAGGCACAATTATAGGCTGCTTTCTCCACTTCAATTATGCTTTGAAAAAGGATTTTAGAGAGTTAGTAAAGAAAGATACAGAACTGGCTAATAAAGCAAGACTCTACGCTTAAAATATTAGTATAAATAATCTTTCAGTGAGATCATTCTAGAAGGAAACTAATGAAATCGCAGATAAAAGAAAGCAAAAAATAGAACCAGTACAAGTTTAAGATATCCAAAACAAATGATAATTATCTAAATAATTTACTTTATGAGCTCTAATTTCTTTTTATATATTTTTTGTATGGTTTTGTATAGGATTTGAGCAATTAAACAGAAATTAAAATTG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1967.6 L-2983.2 L-3782.4 S-0377.4 S-3319.2
S-6380.9 S-9416.8 S-12310.4 S-15370.3 S-24389.0
C-0501.8 C-2319.4 C-4801.1 C-6626.3 C-8237.0
C-10446.8 C-12492.9 C-14468.4 C-16250.0 C-18305.0