Summary
Transcript IDgene_000019145
Gene IDTTHERM_00239380
Length1173 bp
Sequence
AAAAGATTTAGATTTAGAAAACCAACTTCAATCAAATTAAAAAAATGTACAGGTCCATAGTAGTTAACAAATACAAGGATGATGATTAGATTACCATCGAAGATTCCTCTTTAGATGAACTAAGAGAAGAATTAAATGATAAAAATTTTTTAGTTAAGCTTCATGCTGCTCCTATAAACCCACTAGATTTGCTAAAGTTGAATGGGCATATCTTTTCGTACAAACCTCCATTCACACCTGGCTCAGAAGGTTCAGGAGTAATAGTTGAAGCCAAAAATAAAGAACTAATAGGAAAGAAGTTATCTTTCATCTCTCCGATAGGTTCATGGAGAGAATACTCTGTAGTTTCTGAAGAAAATGCCATTTTGTTAGGAGATGATGTGGATCTAGATTCTGCTGCATGTGGATTTATTAATCCATTAACATCATAAGGCTTAGTTCTCTAAGCTATCAACCACAATGCTAAAGGTATTGTCAATTTAGCTGCCCAAAGCACTATTGGTAAGATGATTAATGATTTAGCATTTGTTAGTGGGTTGAATTGTTTAAATGTAATAAGAGGAGATCAAAAAAGAGTTGATGAGCTCAAGGAGTAATATAAAAACTAAAATGTTATCACTTTAGACTAAGATCCCATAGAATTTTAGAAATAAGTGAAAGAACTAAGCGAAAAATTATAGGCTACTGTTTGCTTAGACCCTTTAGGAGGTCCTGTTTCTGGCTAAATCTTTAACAATCTTCCAACAAATAGCAAATTAGTAAACTACGGATCTCTAAGTGGTAAAGACATAGAGGGTATTAATCCAGTATAGCTAAGATGGAAACATAAATCGATAGTAGGTTTTGATATATTTAGTTGGTATGTAGGTTTAAAGCCTGAAGAAAAGAAAAAATCAAAGAACATTGTCAGATAACATGCAAATACTATATTTAAAATCTAAATTGAACAAACTTATAGCTTTGATTAAGTAAAGGCAGCTCTAACATTATTCAGAAGCTTGAAAGGAGGTAGAAAAATAATTTTAAAACCATTTATTTGAAACAATTTATATATATTAAATTTAAAATTTGATTGAATATTAATTAACATGTATTTAAAATTAAATGTAAATTTTGTTTTTTTTATAGAAGTCATTATAGTAGTTAAATCTTAATCTAAATATAAGCTTATGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,529.5 L-26,785.6 L-37,310.6 S-09,954.5 S-39,598.3
S-68,453.9 S-910,192.3 S-127,798.3 S-158,942.1 S-245,387.5
C-0770.1 C-22,074.1 C-45,949.5 C-63,601.3 C-84,491.0
C-105,956.8 C-125,605.4 C-143,524.4 C-163,585.1 C-183,183.7