Summary
Transcript IDgene_000019317
Gene IDTTHERM_00171750
Length659 bp
Sequence
AATAATCATTAATTTGTACACTCATTAACTCATTAGTCTTTTAAATAAATAATTGAAGTTATTCTTGTGCGTCTTCTGTTTGCACTTGGAGACCTGTTTGCCTTATATGCTAAATTTAGCATGATTGTGAAAACGAGAATTCCGAAACCTATTTCAAACAAGAGTCTAATTATGGAGGGGAAATTAGCATTTTCAAATTTGATTGGAATGTCATTCTAAGAAAGACTAAGAGCCGTTATATATGGATCCTAAACTTCTCTTATCTCTAAAGTCAAATCTTCAAAAGATAAATTTTCTTGAACTTAGGCAGCTCTAAATACTTAATAAACATTGTTTTTATAGCAGCCTCTTAAATATTCTACTTATTTTTTAGGAGTAATTTGAACTACAATGCAAACTTAAGTTAACACTTCATATTGAAAGCAAAACTGCTATCCGTCAATTATTTATTTGATTCCCTGCGTGCAAACACATTCACTACATTCAGTTTTTATTTATTTCCATGGGGAGATCTTGATTCCTGTTGCATCTACTTTATCATACTTATTACTAGACATTAAAGAGCATTAAGGCTCTTTTTAGAGTGATGAATAGCTAGACTTATGATAAATAACCTTTTTAACTTTATCATAATATTTTATCTGTAAGCAATATTATGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1338.6 L-2296.8 L-3294.8 S-0343.9 S-3381.8
S-6350.2 S-9307.6 S-12453.4 S-15398.1 S-24397.4
C-0426.3 C-21,339.7 C-4586.9 C-6641.3 C-8337.4
C-10260.8 C-12197.1 C-14189.5 C-16296.1 C-18250.4