Summary
Transcript IDgene_000019358
Gene IDTTHERM_00185570
Length621 bp
Sequence
GAAAATATTTATATTTTGTTACAAGCAATTTTAATTTAAGATTTAGGAAAAGATGTTTTGGAGAAACGTAGTAAGAGGCCTTAATTGCTAATAAGCTTTAAGAAGATAAAACTTCGCAAAGAATATCACAACTACTGATATTCCTAAGGATTCCCACCACTTCGCTGCTAAAAGAAGTGGCTTCACTTAAACTGAATAAGCTCCTTTCGCTTACAATGACGTATATTAATATCCCAAAGATTACAAACCTTGGAATTACAACTACAAGGGTAATGGTGTTCTTTTAGCATTATTCTTAGGCAGTGCTTTCAGTCTTGTTGCTTATGAAAGATCTTATGCTTCAAAAACTGGAAGATATTAAAGAAAAGTTTAATAAAATTACTACTAAATTTGAAAATTAAATTAGCTGATTTGATAAATGATGGATCCTAATAGATACATAGTAGTGATTTATTGTCATAATAAAGTTGACTAAAATGAGAATTAGATATTTATAAAGCTATTTAACATAGAAAGCTAACATATGATAAACGCTTGATAAATTTTAATGATATCTTTTTAATTCCATCATACATATATGTCAGTATTTTAAGACTAAAATACAATTAATTTCAATTCACA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-14,958.9 L-24,307.9 L-35,309.8 S-03,664.2 S-32,346.1
S-61,493.3 S-91,530.1 S-121,566.2 S-151,715.6 S-241,279.0
C-01,034.4 C-2520.3 C-41,053.6 C-61,330.0 C-8851.8
C-101,291.5 C-121,047.5 C-14797.4 C-16892.6 C-18720.5