Summary
Transcript IDgene_000019696
Gene IDTTHERM_00086830
Length611 bp
Sequence
CAACAAAATAGGTTTATAAATTGAAATATGAGTTTTATTAGTAGAGCTTTCAACAAGGGATCAAAGCTAGCTTTAGCACATTTGATGAAATAAAGAAATATTGTTTTTCCAGTATGTTTTAATTTCAGTCAACTATAGAGCAAAAATTTTGTTATGAAAAAAACAGAATTAAGCAATGATTTACTGATTTCTTTATCAATGGGATTTGAACACAAAGAAGCTACTAACCAAAAAGAGTTAACATAGAATTTGATTATTAATAATGTCTTAAAGGATAAAGTTGTATAAGATGTATTTAATGAGCTAGATAGAGATTTATTTGCTATCAACAAGAGCTAAAAGATTTATGCTAACAATCCATTATCGATAGGAAAAGGTCAAAACATGACTTCGCCTTTAATGCACGCTATTGCTTTGTAAGAGATATATGAGAGATTAATGATCTTATTAAAGTAAAAAAAAGGTTCTGAAATAAAAATTTTAGATATTGGTTGCGGAAGAGGATACATTGCATTTGCCATTTCAAAGATTATTGAAAAATGTGATGATTTAAAAGATATTAAAGTATTTGTAAAAGGTATTGATATTTACGAAGATTTAACATATGGTGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,113.6 L-21,773.3 L-31,369.9 S-0137.2 S-348.2
S-650.7 S-967.5 S-1242.9 S-1553.4 S-2446.3
C-081.1 C-276.5 C-458.1 C-637.7 C-859.0
C-1082.7 C-1241.5 C-1440.8 C-1635.4 C-1841.2