Summary
Transcript IDgene_000019697
Gene IDTTHERM_00086830
Length489 bp
Sequence
GTTTATGATATTATACATTCAGGAGTTGCTCTAGAATTAAGCGTTTACAATAATATGATAGGCTAAATTTATGCTTAAAATCAAGAAGGTTCTTGTATTATTTGTCCTGTCATTTAAGAAGATTTAGAGTAGAATTTATATTTGAGATGCAATAACTAGGAACATGTTGTTATGAAATGTGTTTATTCTTAAATGATTACACTTAAATAGTAGGAAATAAGCAAATATTTTTTGGAAGATGGAGAAATTGCTGAAGAAGATTCAACTTCTACTTTATAAGCTTAATCTCAGTAAAGCTAAGAAGAAATGAATCTAGAGTTATTAGAAAATACTAAATTAAAAAGAGAATAGCATAAAGTTGAGCAACAATTATCATAAAAAGAGGCACAGTTGAAGCAATATTTCGAAAATTTCAAAAAAAATAATAATGGCATTGCTCCTAATTTAAAAGAAATGAATAGTAACGAAGAAACAAAGTAATTACTCAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,460.9 L-21,331.6 L-31,105.0 S-093.6 S-337.1
S-640.8 S-933.7 S-1240.1 S-1558.1 S-2471.5
C-0180.0 C-230.1 C-439.6 C-685.5 C-888.7
C-1078.5 C-1251.0 C-1442.2 C-1640.3 C-1830.8