Summary
Transcript IDgene_000019807
Gene IDTTHERM_00355270
Length749 bp
Sequence
GTTTATATAAATCTTCAAAGAGCAGGAGCAACCATTTCAGCAACGAAATCAATTTATGCTAAAACATTTTCTCCTTCAAGTAATTCGGCAACAACGTGATCTCCGTGCTTAATAGGTCCAACACCATCTGGAGTTCCTGTTAAAAATAGATCACCAGGGTATAAGGTCATAAATTTACTTGCATATTCGATTTAATCTTTGATCTTAAAGTGCATAATACCAGTATTGTCTTTTTAAATAGTCTTTCCATTTATTCTGAGATGTAAGGTCAAATTGTATGGATCTTGAACTTTTTCTTTAGGGATAAATGAGCTTATGGGTAAGAATTTATCTTAACCTTTTGATAAATCCCAAGGGAATCCAGCCTTTTTTGCAGCAGCTTGAAGATTTCTATCTGTTAAATCAAGAGCTAAGAAATAACCCCCAACATAATCTTACCAGTTTTCTCCTGATTTTTAAAAGCTTTTATGAGAAGCTTCTTTGCTCATCATGAAACCGAGTTCAATTTCATGATGAACTTCATTTTTAGTGAAGAATTAAACCTTTTATCCTTTTTAGATATTAGGTAAAACAGAAGAGTGGGGCTTCTAAAATATAACAGGCTCTTTAGGAACTTCACTACCACCCATTTCTTTAACATGTTTAACATAGTTTTTACCTATGGCTAATATTTTATTCAACTTGGGGTTTAAAACCTTTGTAAATAGTTATTCCATTTATTTGAGATTAGTACTAATTAGACTTTTTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,806.5 L-22,532.2 L-32,790.4 S-0352.1 S-370.5
S-681.5 S-969.3 S-12134.8 S-15165.3 S-24158.9
C-044.8 C-248.9 C-441.4 C-669.1 C-8276.2
C-10180.2 C-12136.6 C-1475.3 C-1659.0 C-1874.4