Summary
Transcript IDgene_000020055
Gene IDTTHERM_00732520
Length1214 bp
Sequence
CATTTTAAGAAAAATCATAAAATTTTCATATCTTTTTAGGCAAGTAATAGATAGATAATTAATTAATTAATTAAGTCTAAGTATACCTATTCATTTTTTTTAGTTTTAGGAAAGTATCATGTACTTTTATCTTTCTGATTGCAAAGGAATTAATGTTTAGTTTAGAAGTTCTAGTTTTTCTGTTTCTTTTGATAAATTTTGTTCAGCCTCATCAAGAGCCTTAGAGTTTTAGTCGATAAAATTTTCAACTAACAATAATTCTTATTGGAGCTTTTATAATTTTTATTGCACTGTAGATTTTTGTTTTTATAGAGATTCAATTACTGCTGAATGAGTTTATATAGTTGATTATTATTTATTTATCTATTCAAGTATTTCATCCTTTTCTTATTCTAATATTGAACATCTTAGAGAAAATAATTTGTAATTCTATTCAAACGTTTATCCTTCTACATTTATGTTGTCCATATTAGCAGCCATTTACTTACCCTTTTTTTATTAGGAATTATCTAAGCAGGAGTTATTAATATCTTCTATTTCGTCTTTGTATTTTTCTAACAAATGCTTATTATCTGTATATGCACATATAATATTCTAAAGATGTATATTTACAGCATAAGATTAGAGAGGTTTTCTACAAAAAGGGCATTTATTAAGTTTGGTTTTATCTTTTGGAATAATGCAAGTTTTACAAAAAGTATGTCCACAAGGAAATATAAGAATAGGAGAGTTGTTTGGTGGAACCATCAATTCATAGCATATTGGGCAAGTACAGTTTTCTATTTCTTTTGAAATTTTTTACTCTAATTACATTCCTTCTTTCTATTTAGATTTATTTTTTGAGTCTTGAGCTAGCTCCTTTTGAAATTTTTCAGTTATTTTCATCGTTAGCTCTGTGAGTATTTAGTTTCTCTATTACTATCTATCATAATCATTACTCTATTTATTTGATGCCAAACTCTACTATTATTAAAATTTCTAAAATTCTCCTTCTTATTTCTTTGATTGTGTTTGCTGTTGTGAGGAAGAATTAATCCTAGCTTCTATTTACTCATTTGTTAAGCCTAACCTTTCCAATTCTTCATGAGCTTTTTTTTATTATAAATATAACTCGTATTTCTTTTTTGCTAATGCTCTTACATCAACAGGTTAGTCTTAAGTTTCTTCCATTTATTAATTATAAAAATACTCAAATATGAAATTGAAAAATTTGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1758.6 L-2920.6 L-3810.0 S-0598.5 S-3792.7
S-6826.0 S-9942.5 S-12923.2 S-15897.8 S-241,098.4
C-01,216.2 C-26,042.0 C-41,961.9 C-6981.0 C-8720.4
C-101,335.0 C-122,091.1 C-141,568.9 C-161,098.1 C-181,558.1