Summary
Transcript IDgene_000020069
Gene IDTTHERM_00732770
Length462 bp
Sequence
AATCAAGAAAACAAAAGCAAAAATTAAAGTGAAAGAAAATTTAAGAAGAAATGAAAGATGCAAGTAAACTTTTATCAACAAAAAGATAAAAATTTAGCAGAACGATTATCAATGAAAAGTTCTATTTGTAAATTTCTAATGAGTTAGAAAATGAACTTGTAAACAATGAAAATGAAAACTCAAACCACCCTGAATTTTTTGAGTATCCATTTTAAATTGAAGTTTTAGAAAAAGAGGATGGAAGAGTAAAATTTAGATCTTTAGAATAATTGGTGAAGCTTATAAAGTACTTTAGGTTAGAATCAAATGTTTCATAGGATCTTATAAGAAACTATCTTGGATTAAAAGAAATGAAACCTGTTAATTTCGTGAAACATGATAATTTATTTAAATCATTAGATCTCATAATTTTATATACTACTAAGTTAGTAGATAAATTCTTTTCTAATTACTATGCGGATG