Summary
Transcript IDgene_000020070
Gene IDTTHERM_00732770
Length1297 bp
Sequence
AATTCAATAAAATTAAAAGATATTTTCATAAATCTATATTTTAAATATAATTTTTACCTTGTGATTTCTATGAAGTTGAGCAAAATTTGATATAATCAAAAACAGATTTGATAACAGATAAGTAAAAGCAAGATTTTTAGATTTGGAAGCAATTTTTGAAGGTAAAAGGAACAAGAGATATCAATGTTTTCTTAGAAAAGTTTAATTTGAAAGAAGAAACATATACTGAAGCAGCATAAATTTAAGAATTTATTAATAAAACTACTAATAATTATTATATAGATAATAATAAAACTTGTCCTAAACCACTAAAAGGAAAACCTTAAAGAATTATTGTTGAAATGAGAGACATAGATGGAAAGATGAGATTGGCAACTAAAGATTCATATTACAAACATTTAAATTATTTGTTTAAGAATAGTTATTCAAATAATAATTTAAATAACATGATAATATAGTGTTACAAGAATAAAATTATTACTCTCTAACCTTTGCTCTGCTTCTACATAGATATAAAAGATTTGTGTTAAAACATAAGCTACAAGTTGATAAAAGACCTAAAGCTATATAAAATTGAGTAATATCTTTAGAACAGAAAAGTTTATCACTTTGACATCAAAAATAATAAAAAAGTTCCTCTAAATGTTAATAAAGGTATTTTCATTGGTGAAGTATTTACCCCTTATGTCGTAAATAAGGTATGCAATTAATTAAAGCAAATTATATACAATTCATTTGTCAAGACCCTGAAAAAGCAAAAAATCTTATTACACAATTTAGAAATTTATAAATTTTAAGATGACTACTTAATAAAAGTATTTGATTCAGAGTAAGCTTTATACACATCCAAGAAGTTTGTTAATTATCTTTAAAAGTTTGAAGATCCTTCTTTATCAGAATAGATCCTTTAAGATATCAAATTTGAATTATCGAAGGTTGGCTTTGAATATAATGAGTAAAAAGTAAGGGTCATTTATTAAAGGTAGAATATTAGAAAGTTATGGTCACTTAATGGTGAAGGAAAATTGACTGACTGCGATAATTTCTAAATGTTTAAATAAAATATGCTATAGCATGATGAAATATAAGAAAATGTAACAGAATATAAGGAATTTATAAATGGTCTAATAAAAAAATATACAGAAAATTAAGATTTTTTATCATCCTATTCTGAATTGGAACTCTTTGCTATTTAAAAAATGATCCAAAGAACTCTTAAATTTTTTGATGAAGAGGATATCTTAAATTTAATAAAAAGTAATATTCTCAGCAGATTAAATCTAAAAAAATAGCAGGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1199.9 L-2164.9 L-3173.2 S-0125.0 S-3113.4
S-6120.2 S-993.6 S-1297.4 S-1562.9 S-2449.4
C-083.8 C-2248.6 C-4453.1 C-6651.9 C-8373.8
C-10483.7 C-12342.0 C-14337.3 C-16207.5 C-18219.7