Summary
Transcript IDgene_000020328
Gene IDTTHERM_00067000
Length614 bp
Sequence
CTTATCATTATTAAAAGTAAGAAAAATAGATTATTTAATTGTGTTTTACATAAAATAGTTTTATGTAATGGGTTTAAGATTTTATTATTTTATACTTTCATTGCTCTATCAAGAATTTATACATAGGTAATTGAGATAAATTTTCTATGATTATTTGTTCATTAAATGGAGATATAATTAGAGAATCTGCAGAACTCATCCTAAATTTCTCTTTGTTAAGAATAGAATTAACCTTAGCATAAAGAATTACTGGAATAGAAGGTATGAGAGAAAAAGCCTCAAGCTATTTTATAGCTTGGCTTATCTCGTAGCCATCAAAACGAGTGTGTGCGCCTATTGAGGAGTCACAATTTATGAAAACTAAATTTGGCTTTTTGTCTTATATTATGGATATAGAATCATTCTAATCGTCAGAAAACAAAACCTTCACAGAGGGTTCAAACAATTCACTTAAATGTGAATAGGTATCTTTTTAGGTGTCAATAACCAGAATAGATTGTCCTCTAAGCTTTGATAATAAATGCTTTTTTTAAGCTGACATTTGAAATACTTTATTCTAATTGCTATGTTTATTTGTTAGACCTAAAAGTAGGTGTTTTGAATGTTTATTTTGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1642.2 L-2806.4 L-3740.6 S-0265.7 S-3686.8
S-6598.7 S-9581.2 S-12549.2 S-15616.7 S-24434.7
C-0390.9 C-2220.3 C-4408.5 C-6589.3 C-8214.9
C-10280.2 C-12265.9 C-14173.4 C-16133.6 C-1878.0