Summary
Transcript IDgene_000020339
Gene IDTTHERM_00059500
Length408 bp
Sequence
AAAAAATACAAAAAATGAAAAACATAAAATTAAAATATTATAAAAAAGTAAGATAATTTTGATAATTTTGCAATAAAAAAACATAATTAACTTAAATAAGAGTTATTTAAATGGAATAAGTTTTTAAATCTCCAATTATTACTTCAAAGACTGATTTTGACAATGAACCGAACGTAATAATATTCATTCCATTTAAGTAAAGTGATCCACATCTAAATTTTTAAAACCAATAAGTTATTATGTATCAAAAGCTAAATTGATCAAAATAATAAATCTTACTTTTCTTATTCCCCCCTATATTAGAATCTCCTATTCCCTTAGGTACCTTAAACCGAAGAAGACACACAGACACCTATTTTTCTTTATAAAAATACTCTCTTCTCTGAATAAAATAAAATTTTAAGCAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,909.6 L-21,386.1 L-31,164.4 S-0937.9 S-31,245.2
S-61,032.8 S-91,283.4 S-122,181.7 S-151,740.3 S-242,255.0
C-02,408.6 C-22,841.7 C-43,015.6 C-63,133.1 C-81,583.2
C-101,301.3 C-12639.4 C-141,149.8 C-161,200.2 C-181,699.1