Summary
Transcript IDgene_000020691
Gene IDTTHERM_00013710
Length482 bp
Sequence
AAAAGGAATAATTTTTTTTGCTTTAATAGCTGTATTAGCTTAATGCCATGTTAAGGAATTGAATGAATCAAACTTTTTGGAGGCAAATATAGTATTAAATACTATTCATGATGGATATTTTTCCACTTTCAAAGGACCAATTTGGAATTATCAGAATAGATATTTAATATTTTAATCTTGCCAATAGGAAACAACTGCCAGTGTTTAACAATAGTTTATTGATAAAGTAGTTGCAAAGTTACCTGATAATTTATATGTTATACCATTTTTTGTTTTTGAATCAGAAGCAAACATTAATGAAAACATATAAACAAGAGATGTTATTTTAACAGTTAAGAGAAAATATGGTAATGGTCTAGCAGTTAGTATATCTTTGAAAACTGATGAATCTGATGAATAAAAGAATTGGATTGAAAGCTTTGAATAGCTAGAAAGCATCATTGATAGTACTACCCACTACTTTGGAGATTAGGCTATAAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,050.4 L-21,121.6 L-3752.2 S-0320.7 S-3451.8
S-6498.1 S-9533.8 S-12523.8 S-15528.8 S-24352.4
C-0107.2 C-2278.2 C-4140.0 C-6273.3 C-8269.3
C-10237.1 C-12485.1 C-14282.4 C-16221.0 C-18164.7