Summary
Transcript IDgene_000020816
Gene IDTTHERM_00657300
Length310 bp
Sequence
GAAGATTTAGATACAGTTTTAAATTATCCTTTCGACATCAAAGCAGTAATCTTTAAGTAAAAAGGTTAATTAAAATTTTATGAAAATGGATAACTGTACTATCTAAACCATGACCTCGAATGCATTGAAAAAGGCTAACCATCTTATTATGATCCTTAAGCTTAAATTTTTATAAAGCGAAACAATAAGTTTAGGTCAAAACTACTCAAGAAAAGCTTAAAAAAATAAAAATAAGAGCACATAAATGCTTGAAGGGATGGCGAATAATGCTATGAAAATAAATTATTTACAGATGAAATTGCAAAAAATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,388.6 L-21,364.4 L-31,261.1 S-0108.8 S-3116.8
S-6119.5 S-9128.2 S-1277.7 S-1599.6 S-2487.7
C-063.1 C-2128.7 C-473.5 C-650.7 C-872.7
C-10103.3 C-1291.3 C-1471.3 C-1661.7 C-1856.7