Summary
Transcript IDgene_000020818
Gene IDTTHERM_00657360
Length786 bp
Sequence
AGATAAACAAAAGAAATAACAACATTATATTGATTTTAGCATACCTTAGTAATAAAAGTTTAATATAAAGTTTAAAATGATGAACTTTTAGAGGCAACAAGATATAAACGCAGTTGATTTCTTCGGATATTACCATTTGATGAATCAATTTGTTATAAGATCTTGCAAGGATTAGCTTACAAGTATTTAAGTTAAATAAAATTCACTTTTTGAAGTAGGGTATAAAATTGGGAGAAGTGTAGTTGAAAAAATTACAGAAAATTGCTTAGATAAATTCAAAGAAGATGTAGAAAAGAACAATGCAAAATGTCTTCCTCAAATTAAATTTATTAGCAAAGATTTCTGGAGTTATTTATTTTAGAAAGACGTAGATAAAGCTAATCATAATCTCAAAGGAACATTTTATTTGAAAGTATTTACATTTACAATGTTTGAAAAGCTATCAAACACAGAGTCTCCCGAAGTTTAAGAATTTGTCAGTTTATGGTACTAAGTTATTAGAGGATTAGTTGCTGGAGCTATGAAGGGATTATCTTACCCATCTGAGGTTTCAGTTGATTCTGTTCCTCCAGAAAAACCAGATCATATTTAACCATTTATGATATCTATTCAAATATTAAATTATCCAGCACTGCTGTCATCTCAAATTTAGCAAAAGTGATTGATCTAAATGTCAATTAGATTATCTTTTAAAGCAATAAAATATCAATAATTAAAAATAATTTATATCTGTATGATAGATTTATGTATATAAATATGTGTATAAGTAATTATTTCCAATTCCCT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,571.6 L-21,400.1 L-31,436.3 S-0896.8 S-3882.1
S-61,358.1 S-9899.6 S-12828.1 S-15943.0 S-24770.5
C-0519.4 C-21,025.1 C-4703.8 C-61,617.3 C-81,500.2
C-101,727.9 C-121,059.9 C-14749.8 C-16802.3 C-18955.1