Summary
Transcript IDgene_000020945
Gene IDTTHERM_00310820
Length1160 bp
Sequence
AGACCATCACATATAAATAAAGAAATAAAATTAGTTATAATCTAAATATTATGTCTCATTTTTTAATCAGTTTTATCAATCAATTAAAATAAATTGTTTCCATATTTATTTAATATAAAATTAAATCATTTTTTATTGCTGTGATTTTTCATCAATCCCTAACATTTTTTCTTCCACCTGTCATTTCATAATTATGATGAGAATCAGATTTCATTAACTTTTCTTCATATTTACGACTATAATAATTATATAAAGCTTCATGTCTTCTTACAGTTGTGAAGTAATTCCAAAGAGAAAAGGTAGTTAGAGTAAAAATAGAGTTTCTTATTAGAGAAGGTACAATACCTTTGTAGAGAGTAAATATACCCATATCTTCTTTTATAAGTTATTGTATGTATTTATTTATAGAAGGTATTTCTGAAGCTTATAGAGCTCTTATACAGTATCTGTGATAAATAAAATCAAGAGGATGAGTGACAGAAGTTGTAATTAAACTTGTTAATAATGCACTTGTGCATACCTTAAACCCATCGCTTTTAATTTCAGTTTCTTCGTAGAAGTATCTTAAAAATTTAAAAAATATAAATATTTCTGATACTGCTATGCTATTTTAGAGAATCAATCCACTTCTGATTCCAGTTCCCATAAAAATGGTAGATTTTCCCTTGTGATACTAACTTATTTTGCGATATTTTTCTTAATAACTTTCATATTTAGTATAATCTACACCTAAAGGTTCACATTAAATTTTAATTTTTAGAATATTAGAAGGTTGCTATATTAAAAAACTCATAGATTAAGCTGCTATAGCAGACACGTAGAGCTAGAAATCACTTATTTGCGAGTAAGGTTAAAGAGGACGACCGACTAAAAAATCAAACACAAAAAATCTAACTAAATTTTAAGAAAGAATCCTATCAATACCAGCTCTTAATCCGTAAAATACACCAAATGATTTTTCTGCTTTCAAGATATCTTCATAAATAACTTTAGTTTCTTTGAAAATAGATTTAGTTGTAAATGTTTAGCGAGCTATTTCTCTAACCTTCAATCTATCGAAAGGATAGGCTAAAGCTTCTCCTACAGCTGAAGCAAATGCAATTATACCTACCCTTCTAATAATTCCTTTTTCAGATAAGTCAAAGTGGCTATAATTCATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,038.8 L-2918.8 L-31,043.5 S-0427.8 S-3214.3
S-6186.1 S-9153.9 S-1290.3 S-15157.6 S-24214.7
C-0178.2 C-2157.3 C-4132.7 C-6163.0 C-8233.0
C-10261.5 C-12366.8 C-14264.4 C-16155.1 C-18100.7