Summary
Transcript IDgene_000020993
Gene IDTTHERM_00773560
Length1317 bp
Sequence
CTCGAAGCATATTTTAAAATTTTAATCTTTCTTTTTACACAAATTAAAAAACATTTACAATATATAAAGTAATTCATTAATATGCAGTTTCTGAATCAATAATCTCAAACTCTACCAAGTTAGGTAATGCTTTTTTAATTTTCTAAATAAGCCAATGGTAATCTGGAATAGAAATATAAGTTAGGTTTTTAAGGCACTTAATTGTTGCCAACAGTTCTCTTAATTTTTAATGATCCATAATTTAAACAGAAAAAAAATCTAATCTTTTTAATAAAGTAAGACTTTTTAAGGCTTCAAGCTATTACGTGTTTAAAGTTTTATCTAAAACCAAATTAAGACTCTGCAATGAAGTAAATTAATTTAGTTTATCTAATATGTTGCTATGATTTAAAGCCACTATTCTAAGTTTAGTTAATTGCTTTATTTAGGAAATAAAATCAATTGCTTAGTTATATTCTACTTCTTATTCTCCTATTCTAACTGTATTTATTGTTACTGATTCTATGCTAAGTGATTTACAAATATTTTAAGAAAGTCTCATAATATTATTACTAAATTGACCAACCTCAGCTATATCATTATTTTCGATTCCAATACCTAAATGCTTGAGATTAGGAAGCTTAGATAAATGATATCCTAACAAATCATAAAAAGATTCATTTTTGATGCCTGAATTAATATGGAACTCCTCTAATTAAACTAAATTTTGAAGTTTTCTCAATTCTTCTTTGAATTATTCATTACATTCGATATTTTTAGTTAAATCTATGCTCAATCTCTTTAAAAAGCTGCATTTAAATATCATTTAAAATTAGTTAGCATAAGTACTGTCGAACAATAAATTAGAATTGTTTTAATGAATACTCCATGATTCTTAAATACCCAAATTCTGAAGTTGAACTATATTATAGATATCATTTAGAAGATATTCTTATCCTTAACTATAAGACTAAACCTATAGAATCTTTAAATTTTTTAACACCTTAAGCTACCCTAATTAATAGGAGACTTTTTGTAGTAAATCTTTGAATGCTGGTGTATCTGCAAATAAATCCAAAAAAACATTTATTTACAAATCTTATAATAATCCTAATTTTTTAAGGGCTGAAAAGCCATTTATGATCTATTCCTCTTAAATTTTTTTTGCAAAGCTTATTACCAATTAAGGGCTATACATGTAAGGGATTTTTTAGCTTTATCCTTATTCTGGGAGAAGAAGTCTCAAACCTTTGTCTTCATCTGCTGTTATGCGATCCCATTTTTATCCTTTTAATTTCTCTAATAAAGCAGAGTCTTCCATTTAATATTATTTTTGTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,034.7 L-2804.8 L-3744.3 S-0270.4 S-3222.7
S-6329.0 S-9347.6 S-12369.0 S-15401.3 S-24439.3
C-0303.3 C-2407.3 C-42,564.8 C-61,480.3 C-8519.1
C-10454.1 C-12393.7 C-141,084.5 C-16791.3 C-18626.1