Summary
Transcript IDgene_000020998
Gene IDTTHERM_00773780
Length2823 bp
Sequence
AAAAAATCGCCTTAGCTAAGAGGTAAATACGTTTACTAATGAACTCAAACAAATCTAACAGTAGAAAAAAGAAAAAGCACAATATTACTTAAGCAAATTAGATAAAGGTAAAAAGCCTTCATTAATTGATACAAGCAGTAGTGTGAGCAGTAGCAATATGAGTGCATTGAAATTTTTACAATCAAATTAAATAAATTAAAAACCATCAAAATTGTAGAAAGCAACATCTAAAAGTACAAGTAAAATAATAAATACCAGCTCAAATGGTAAATCTACTTATAAACCAACTATCAACTAAGATAGCAGTAACATGATGATGAATTAAATTCTTGATTCTAAAGCATAGAATTTGTAACTTTGTATAAATACTTCTGGATCCTCTGTCGTATCGAATATACATACTCATCATTAGCAACCTATCTAGCGTAGTGAAAGCAAAGACATAATATAAAAGAAATTAAATGAATTCAAAAAATTTAAGGAGGCCTTAAATTCAGAAATTACAGAATTAAAAAAAGAATTTGATAGCAACGATCCTTTTCTCGCCTCTTTGAATTTTGAAAAACTCAAGGAAAAAGCCCTAAAAGATAAAAAGACTTTGCTTGGATTAGATAATTAAAATATAAACAATACTGGAAGATTTAATAGTGCATAACTGAATTAAAATTAGCATGAAGAAACTGAAACGGTTAATTATATGTATGAGAAAGAATAAAATAATGATTAAGATTTTTAGACACCAGTCACTCATGAAAGAGGACCATAATCAGATGCTACCACTCACTAAAAACAGAATATAAATCAATCTCATTGTAACAATAACAACCAGAGAACTGCTAGCAAAACTACAATTAGCGAATCTCGAGAAACAGCTTCATTTGAAAAATAAAAACAATAAATTCATTCAAAGAATTTTAGCAAAGAACTTCTTTCACCTTCAGAGGATATTTTAACTATACATCAAAATAACTCTCAAATTTAATAACAAAGTGGATAATTTTTGAGCAACATGCTCATGACTGAGTCATACACAGGAGATGAATACATAAATAGCGATAGAAAAAACACAAAAAGAAATAATACCTAAGAGAAATAAAAGTAAGAGTATAAAATGTTTTAGAATCAGTTAAACTATTTTAAAATGCAAGAAACTCTAAACAAGCATCTTCGTCAATATGAATCTGAAATCCTTGAAAAGTAGGCAGCTTAAGAAAATTAAAAATAGCTTAATTAGCAACAATCTTAACAAATAGATTAGAATTTTACTACAACTGGAAACCTAGGATCAATTTCTTCATCTGCACCTTCTGTTAAAAATAATTCTGATTTAACTGCTGAAAATTCTAAGAAGTAGACCTAAAACTTTCAAAATTTAGTTATGCAATAAAATAAGCAGCAAATGTAGACTCTTATTAAGTAACAGTAATAGCTTTTAGCATAATAAAATCAATGTACTTTTAATGTAAATCAAAACAACATTAGCCAAGAGAGTAGTGCAAGAAATTCATCACATATAACTCAACAGCACCAATAACAAAATAATAAATAATAGATTTTGAACTCAAGTGAAAAGAAAAAAGGAATAGATTTATGTAAGAAGCAGTTATTCCCTGAAGGAGCAGAATTTAGCGATGATGAATTCACTTAATAATAAAATAATTAAAATATTTAATAAATTTATCTTTAAAAATAATCTATTTGCAGCAACCCAGTGAATATAAATGATTACTCTACGAACGATAGTCAATAATAGTAACATATCCATAATTCAAGAGAAAAGTAAAAGTAGTTGACTTAATAGTAATCTTAATAAGTTGTCACGTAACCAAGATATATAGAGAACTAAAATGAAGTAATACTGAAATAAATAAAAAAGCAGTAAAATGAGTCACTTTTAGCTAACTAGTAATCACCGTTACAGCCTATGAGTTACATTTAACATTCAAACTAAAAAACAGGGTAGAATTCAACTCATAGCAACCAAACAGGTTAAATTAATGGAAGTTCAGGTTAGTAACAAAATACTCTGTTTTACAAGACCCCGTAAAATAGCAATAATTATAATACTAATAGCAATTCTAATTTAACAAGTGCATACTCCTCAACTGGTGGTAGTGTTAACATTAAAAATTTATCTCCTTAGCAATAATTACAACAAGAATAATTTATACTTTTCCTCTAACAAAGCAATTCCCATTTGCACCAATCTGGCTCAGGAGGATTTACTGATAGGTAATACAACAAAGGTTCAAATAGCTCAGAAAAAGTATACCCTTCAGGTGACACATTCACAAGTCCATTAATGAATTTAAAAAGCCCTGACTTGAATAAAAGCTAAAGTTAACTGAAGAAAAGTGGTAAAAACTCTGTTCCTTCCCTTCCTAAGAGTCCTAATTCAGTTATTAACTACTATTAAGATCCTATAAACTATAGCAATATTACTGGGATTCAATCGAATCACTCTGAAAGCTTAAACTATACTGCATCTATAGGCACAACACCTGCAAAGTCAAACTTTTACTCGACCCCACTTTAAAATTAAAGCATAAATAATACAAATAACAACTTTTTTTTAACAAACACTTCTTCTTCAATGTAAAATACAAACAATAATATGATAGTTACAAATACAAATACTCCTTAGCAGTTATCAAGTAATACTGTGTAGTAATTAAATAACTCTAATAATCAATTAATATTCACTAAAAACTCACAAAGCAGTAATTAGTTTCAGGTAACAAATCAATACTAAGAATAGCCTTAAGAATACATAACTCCATAAAAAAAATGATAAACCATACTAATATCAATCAATCAATCAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1585.0 L-2580.4 L-3711.2 S-0735.1 S-3573.7
S-6391.2 S-9522.8 S-12500.0 S-15457.0 S-24595.0
C-0512.0 C-21,667.5 C-41,385.8 C-6664.8 C-81,028.9
C-101,522.9 C-121,319.4 C-141,079.1 C-16700.8 C-18855.8