Summary
Transcript IDgene_000021116
Gene IDTTHERM_00600300
Length820 bp
Sequence
AAAAGTAGTTAATAAGTAGAAATACAAAAAAAAATATGAGTAACAATTAAGAAATTTTCGAAAAACAAGTTTAAAGTCAAGATTTATAAGAATAAGAATGTAAAAAGAAACCTAAGAAGTTTTTCGACATTGACAGTTTGCTTAGCAAGCTCATAAAGCGTTTAATTCCTTAACAGCTAAACTAAAAAACATAGTTTTGTAAGCATGACTGTGGGTGTAGTGAAGAAATTATAAAGTAAACCCTCAAGTCTTTTTTGCTTGGTTATAGCGTTATAGGAGCAGTTGATATAATCGCATTAGTTTTAAAATCTAAAATGTTAAAAAAGAACCCATTTATTTTGTTTGTAACCTTGGTCTCTAGTAAAAATATTCGCTTTGCCTCCTTCCCAGCTTTATATACTCTTGTGATGAAATCACTTATGTGTGTATTGAGAAGAATTTTTAAGGAAGATAATGGCAAAATATGGTTTATCAGTGGCTTTGTAGGAGGATTCTTGAGTTTACTGACAAAAGAAAAAAATAATCGTTCAATGTGGAGTCTTTTCCTTTTAACTAGAGCGTTTGAAACATTTTATAGATATCACATAATTTAAAAGACTATTCCTAAATTTTAGCTAGATTATGTACTAGTGTATTGCTTGATGATTGGCTTCACAGTAAGTGTTTACTTTACTGAACCCTCTTGCAATTCAAGAGGTCTTCATAAGGCATGGGAAAACTTTTCATGCGAGCACAGTGGAGACTATGGAATTCGTAAAATTTATATGGGTATAATGAATAAAAAATTGCAAATTGATGGTTTACCTACTGATGAGCCAGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1745.9 L-2516.8 L-3497.9 S-066.2 S-3368.1
S-6762.3 S-9529.2 S-12367.9 S-15324.8 S-24283.7
C-0496.1 C-2463.4 C-4192.7 C-6134.8 C-8189.2
C-10328.4 C-12333.5 C-14311.5 C-16352.7 C-18546.6