Summary
Transcript IDgene_000021121
Gene IDTTHERM_00600400
Length664 bp
Sequence
GCTACTCGCTAAAGCTGAAAATTTTAAATTATCTTAAATATAGAAGTACATTCAAGAGTATTTTCCGAATGTTGAGGTAACATTTGAAAATGAATAATTAAAAGAAGAGGAAATTGTTTAAGATTTTCATCTCGTTTCATACGTTCTAACTTGTTTCTTTACTTCAGCTGAGATATACAATAATAGCCTCAAAAAGAATTTGAATAGCACCTAAAACAATAACAGCCAACAAGAATAAATGGATTTTACTAATATTTTCTCAATGCAATAATTCAATTAAAATATGATAGCATCAATAAATCCATAATCAGAAGCTAATAATTCTCCTAGGCCTAGGCTAAACAGCTTTTATGAAAATATTGTTACTTTACCTAATATTGTGAGCAGTAATACAGCTTTAAATCTTGCAAATAGTGCTAATAACTTAAATTTTAATAGTCAGGCCCAAATAAATAACGCGATTATTATGAATACTCAGAGTAATAATCCTAATAATTAATTTTCTACAAATATAAACATTCCTTTAAATACAAATAACTAGTTTTAAGGAAATGCAAACAATTCATACTACCCAAATAGTGAAAAATACATAAACTTAAACACAAATAAAAATATAAACCCTAATAGTAATAGTGTAATTAACTATGATAATTCTCCAAACAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1982.5 L-2519.8 L-3289.7 S-0222.0 S-3427.5
S-6293.9 S-9338.9 S-12261.4 S-15429.8 S-24402.7
C-0952.1 C-2302.4 C-4207.4 C-6269.5 C-8226.6
C-10383.8 C-12381.6 C-14428.4 C-16313.5 C-18407.4