Summary
Transcript IDgene_000021122
Gene IDTTHERM_00600400
Length800 bp
Sequence
AAATAGATTAAAAATAAAATTCTTTATAAATAGAAATATTCACTAATTTAACTATCTTATAAAACAATAAAAAACCAGAAACCTAATTATGCATCAATTCACAAGATTAATCGAATTAATAAATAACATTAGTTAATTTGAAATCAGCCATTTAAGCTACTACAATATTTAAGAATTCTAAATATTAAAAATCAGGTACTGCCACATTTGATGGAGACTAAACCAATTCCTGCTAAAAGTAAAATAGAAAAACAGGGAATAGCTAATAGCTGATCGTTAATCCCTAAGAAAAAGATTTTAATTCTTTGACTATCATACCATCTACATTCCGCGAAAACTTATTGTGTACTGTGAGGACTTAAACAACGTAAAGAGCAAAGCTTTCAATAGACACCGATAATATAGATGCAGGAACTAATCAGAAAGCTCCTTCTCAATAAAGCTAGAATGGTAAATACTAAATCAATTTATCTTCAGAAAAAGGTAAAAATAACCCAAACTACGGTGTTATAAAATCTGACGAACACTTAAGATCAGCATGTCCTAAATCCTCTCATATTACTTAAAATTATCATAAAATTCACATGTAAAAATATGGCAAACTTCTTTCAAAGGAAATAGAAAATGAAAGAATCGTAGAAGTCTCCATGACAGATTCTAATAATATACCTTCTAGACATAGAATCTCTACAGTTACTTAAAAAATAGATGAAGCTAAAAGTGAAGGGTTTCCTGATTCTAACATCAAAAGATATGTATAAACTTACTAATGAAGCAATTTATATGTATTTATTTATTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,944.8 L-21,441.4 L-31,181.7 S-0723.9 S-31,312.6
S-62,612.0 S-91,693.9 S-121,317.8 S-151,272.5 S-241,253.8
C-01,954.4 C-2674.0 C-4531.1 C-6585.1 C-8913.2
C-101,511.7 C-121,197.0 C-141,122.5 C-161,068.6 C-181,379.4