Summary
Transcript IDgene_000021126
Gene IDTTHERM_00600450
Length2517 bp
Sequence
AAAAAAATCAAAAAATAAAAAATCAAAAAATGATAACTTAGTTACCAAAAAGACCTAACAAATCCTCTTCTTCTACAATTGCTAAAATTAGTAATAATATCAGACTACTTACTAATATGTTTAGCATGTCAATCCATGATCCTGAAAATTCAGACTCAGAAGACAATTAAGTTAATGATAGAAACCTTATGTGCTATTAATATGATGTTAAATTTGATCCTAGCATCGCAGAAGATAACAGCAATCTAAGATAAAAAATTTTTAAATAAGCTCGTCTAAGCATATAAAAGATCATAGGCAGGTTTAGCTTTTCTGGAAAATCTTTATACTCTTTGAAGCGTCTTGATTAAAATGCCTTAGATTCAGTTAGTTTAGAATCAGTAAGGGTCGATGATTAAACTTATTCACTTTCACTAACATTTACAAAACTCTTTGAAGTAAATGAAGAATCTGCATAAAACAAGGATAAGACTACTCCAAATTATAAGAAGGGTAATAAAGTAACTTAAGTATTAAACGTTATCCTAAAAAATATCATAGACTAAGAAGGATTCAAATAAATAGGAAGGAACTCTTAATTCTTTGACTTATAATCTAGAGCAGATGTGGTCATCAAAAATTAAAATAATACCTCAACCCTTGAAGTATATAAAGGTATCACTTTCAAGGTAAGTCCTACTTAATAAGGTTTATATCTCAATAGTGATTATCTTTGTAGAATTTTAAGAAAAGAAACAGCCCAATAATACTTAACTGCAAGACATGATATAGAAGGATAGTCAGTACTTACTAAATATAATAATTATCGGACATATATAATTGACAGGGTAGATTATAGTAAGAATCCTAGATCAACTTTCTTGTATAGAAAAACAAACTTATAAATTAGTTACGCAGAGTACTACTTTCAAAACTATCAAATTGAAATTAGAGATATGTAACAACCATTACTTGTAAGTAAAATAAAGTACAGGGAAGCTGACACAAATATTCTAAAAATTTAGGAGATATTTTTGATACCTGAATTATGCTATATGACAGGACTCACTGATGAACAAAGAAAAAATAAAAATGCTATGAAGGAAATAGCTACTCATACTAAGCTTACTCCTGAATAAAAATACTCAAAAAGCGTCTAATATTGCTAATTGTTTGGTCGCAAAACAATTAAAAGTGGAATCAGAATTAGTCACACTGATAATAAAATTGATGCTATTTAACTTAAAGCACCTAAAATAACTTTTGGTGGAAAGTCTTTCATTCCTGAGCATGGAGGAAACTTCGAAACAAGAGCACCTACTTAAGATTAAGTTTAATTTAAAGATTGGGCTATTATCCATCATAAAAATGATGAAAAAGAAGTTTATAAGTTTATAGACCTTCTTAAGAATGCGTCACAAGCATATCAAATTAATGTCAATGATAAACCGCAATTTTTCGCACCAGAGGATTTTAATCCTAAAAACTGGATTAGGTTGTTAGACAAAGATTTTAGAAAGAATGGAGTTCCTTAATTCATTGTGACTTTCAGCAACGCTGAAAAAAATCCCTCCCTTTACCGCGAAATGAAGAAATTCTTTTCTTCTGAAGGTGGTGTAGGAATAGAATCACAGCATGTAACACCGAGAGCCTTGCAAAAAAATGGTAAAAGTGTAGCCTCTAAAATTGCTTTGCAAATTGCATCCAAACTCGGAAAGCGCATTTGGTCAGTAGAAACTCCAGTTGGAATTAATCAGAATACTATGATTGTTGGCATTGAAACTAGTATGAAAAAAATCAGGAATTAATAAGTCATTGGAGTGGTAGCTTCTATTAATAAAGACTTCAATAAATTCTACTCTCAAGTTGATTTTAGGAATGGCAATGATATCAAACTACCAACCCTCTCTAAAATTATATCAAGTGCTATAGAAGCTTATAGCAAGAATACAAAAACTGTTCCTGAAGAAATTATAATTTACAGATAAGGTTTAGGCGAAGGCTAAATTTAGTATAGTCACTAACTAGAAATTTAAGCAATTCAAAATGGATTCATCAACTTTAAACAAGGTTACAGTCCCCGCTTTGCATTTTTCTAAGTTAATAGGAAAATAAGTGAGAAATTCTATCAACAGTTATATAATGAAAGAGTACAAATTTCAAATCCACCCTCAGGTACTATTGTAGCTTCTGAATTAACTCAGAATAATTTTGAATTTTTCATGGCTGCTTAAAATTGTAACTCAGGAGTCTGTACACCAACTAAATATACATGCCTATTTAACAATACTAACTTGAAAGAAGATTAATTTTGGTAATTAACTTATTTCCAAACTTTTAATTACTATAATTGGTAAGGACCTATTAGGGTACCTGCTGTCATGAAGTATGCAGAAAAATTAGCTAAATTTACTAGTGAAACTCTTGAAGGCGTTGCAAATAACGAGTTAATAAATAGCCTATATTATATTTGAAACTAAAAATTTTTCTCATTAATTCATGCTTTTTATATTTATTTTCTTTTAAAATTGATAGTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1134.6 L-2210.7 L-3258.5 S-0259.0 S-31,285.5
S-64,913.6 S-96,670.2 S-126,564.4 S-154,872.2 S-241,794.9
C-0573.1 C-2254.0 C-4502.7 C-6359.4 C-8572.2
C-10614.3 C-12407.1 C-14488.8 C-16718.8 C-18665.1