Summary
Transcript IDgene_000021192
Gene IDTTHERM_00481340
Length1225 bp
Sequence
CATAACCATTTAGGTTTAAATAATAATTAATAAATATAAAAATAAATAAATTAGCAAACTAAAATGTCAACAAAAGAATTCAGCCTTAGCTATGAATACTAAGAAGGAAAGTGGTAAGAAACTAAAGAGTCTTCTTGTTTTTCCTCACAAAGTTGCAACAAAAATCTTAAGATAGGAGCTTTTAATGTTTTATGGGGAAATTCTAATAAGTTTATCAACATGTTTAACAGAAACGAGCAAAGATTTAACTATATAATCAATAAGCTGATTCCTCAGACTGATCCAGATATACTCTCGCTATTAGAAGTTTCAGAATAATTTATGGAAATGCTTACTTCAAACTAGCATATTAGAAATAATTATTACTTGAGTCATGTTAAAAGAAAAAGAATTGACTATGTTCACGAAGTGGTAATGATATCCAAGCTTCCTTTTTCTTCTATTTTTATGAATGATGATGATTATGGTAGATGCATATTTAGTATTTTTACTGATTCAGTACCTTCCAATAGTTTTATGGTTTTAACAAGTCACTTCTGGGCTTATGAATAAGATTATGTAAGTAGAAGTAAGTAAATGGAGCTCATAGATTTATCAATACAAACTAACTCTTTTTTAGAAAATGTTAATCTTCCAGTTAAAATATAAAAGGCTGCTTTAGAAGCATCTCAGAAAAGCAATATTATATTGTAAGGTGATTTAAATTTACATTTAAAACACGAAGATTCGTTTATCTATAAATTTGGATTTGTAGATGTTTGGAGAGAAATTTATCCTCATGATGATGGTTATACTTGGGATGCTTAAAAAAACAAATTCGTAAAGAGTATTTACATTTTAGACAATAGAAGGATGAGATTAGATAGAATTTTACTAAGGTAAAATAGTCATCTCTTTAAAATCATAGATATTTAAATTAAAGCTCAGGAATCTATAGGGTTCAATTTATGCTGCAGTGATCATTACATGTTATTGTCTGAAATTTAAATAAACAAAGAGCCTAAAATGTACATTTAAAAGTATGATATCTCAAACATCCTTATGGAAAAAAAAACAGGTTTCAGATCCTTTCCAACAATAATTAAGTTGAGAATTTTACTTTTAATTTCCATACTTTTAGGGATTGTGATTACACCTTTTGGAGTTAATTTATTAAAAAGGAAATTAATGTAATATTGAAAGTGGATTTATTTAAATTAAAAATAATTAATTTTTTATTATATTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,215.7 L-21,549.7 L-31,456.5 S-02,538.1 S-33,975.0
S-66,630.4 S-96,366.6 S-126,243.9 S-155,175.3 S-244,971.5
C-0123.8 C-2911.0 C-4426.2 C-61,004.3 C-81,190.2
C-10328.1 C-12157.3 C-14122.0 C-16309.3 C-18265.6