Summary
Transcript IDgene_000021501
Gene IDTTHERM_00627140
Length599 bp
Sequence
GCTTAAGTAAATAGATAAATAAAGAAATAAATGTTAGTAAATTACGACGATTCATCAGATTCAGAAATTGAAAATGAAAAAGTAGAAAAAGACCAAAAGCCAGAAAAAATAATTCCAGAGTAAGCTCAAGATTAATAAAAAAAGAAAGTGAAACTTTTAAATTTCAACTAAGTTATGAAAAAAGCAGATGAAAAAAGTAGCATCACTGCATCGTCATCATATACAAGCAATCTTTTGAATGAAGCTAAGAAAATAGATTCATAGCTAAACAATGCAAATAAAATTAGTAACGAAATAAATAGTAAGAGGAAACTACCAAAAGATTATGAAGAGAAAGTAGATTGCCCTGTCGAATAAAAGTACCACAAATTAAATATAACAGAAGAAGAACTTCAAAAAAGAAAGATTGAGGAACAAATCGCAAATTAAGCAAAAACATAAAGCGAGGCAAAGGAAAAATAAAAAAAGCACATGTTTGTTCCTCCTTAGATAAGAAATAACACAAAAAATGTTTCAACTGAATTTTGAGCTCAATAATTTAAAACTTAAAATTAAGAGTTATTTATAATCAACATAGAGTTAATTTTGTACTTATATAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,230.9 L-21,006.7 L-3609.1 S-01,604.0 S-31,145.3
S-61,932.1 S-91,159.5 S-12800.5 S-15901.1 S-241,328.3
C-01,268.5 C-2586.1 C-4449.1 C-6954.0 C-8669.3
C-101,316.0 C-12892.8 C-14501.9 C-16390.6 C-18376.4