Summary
Transcript IDgene_000021718
Gene IDTTHERM_00202840
Length1881 bp
Sequence
ATAATTTAATGTATTTTTTAACTGCTTTGAAGGCATTTTCTTAGGATAAAAATGACTTCTTAATGCTTTGTTCTATCAAAGGCTTGACTTGAGATAGTACTTTATGAGCTTCTTTTTAGCGATACCCTTTTTAATTTTCTAGGTATAAAGAAAAAATTATTGAGCAAAGCAAGTCTTTACTTAATCCTGCTGAAAAAAAGTATCCTATTAATTCTTATAATTTACTCATGGAATCAATAAATTACAGGATAATTTACTAATCGTATTTCCAAAGCTTGTTATCGGTATATTTACTTAACAAGATACTTTTTAGATTATTTAATTTTTTCTTTTTTTGTCTATTTTTGCTAATAGGTTTCATAACACCACCTGTTGCAGGAGCAGATTTTCTTGCAGATCCTTATTTCTTCCTATTCTTTCTATGTCTGCCACCTGCTGATCCTGTTGAGCGGTAAGTACTTTTTGTATAATCTACTTTATACTCTTCATATTCTACAACTCTTGTATCTGTTAATCCTTGCAAAGAGGAAATATAAGATGTTAATGGAGTTACGAGTTAGTATTTAACGCTTTCTTCAATTATTTTCTTTTTTTGTTCTTAGCTTTGCTTCAAGTTAGAGCATTAACGATTGAGGTAGAGTTGCTTTCCTATCAAAAATATTGTCTTTTTTAAATTTTAATCTTGCAAAAACTAATCTTATCCATTCAGTTCAATTTCTGTCTTTTCAAATTTCATATTTGTGCAGTTATAGTAGCTTATCTTTACTTTTTTCTGTTTGGTTTAAAGCTCATTTAAATTAATTCCTTTTTTCAAGAAAATATGCATGAAAAATTGCTCATTTTTCAAGACAGAAGGAAATTCGTCTTATTGAGGATATATAGACTCAACAATAGATTTATCATATTCAACTTGGAATTTAGTATAGCTAGGAGTAAAAGAATTTTCTAGCACATTGATAACAACTTCTTTCAATTCAGAGGCATTATCAACTTATCTATTAGCTCCTCTGCCTGACTCAGAGCATCTCCTTAGTAATTATTTGTCTACTCCGCTGCCTAAACCTATGCAATGAACTCTAGCTTTATGCGAATTATTTCTGATTAATTGAACAACCATGTCTGGTTAAGAAACTTATCCATCAGTTAATAAAAATATTTGCATTTAATACAGATCGTTCACGTTTTTACATTAAAAGATTTTCTCTAAAGGCTGATAAATTTCTGTTCCTCCCATGTCAGCTGAGAATTTGCTAATTTATTCTAAAGCACTTTTCATTGATTATTTATTTTTCTTTTTTGCTTCCTCAAAGAGGAATTGATAGCCAGATCCAAAAGAAATAACATTGAAATAACTATCGTCAGGTAGTCTTTATAGGAATTCAATAAGTGTATCACGGGCCTTTTAGAAAATAGTGCACATCGATCCACTTCTATCGATTAAGAAGAAAAATTATGCCTTGCTGTGTTTTTCGGCATTTAACACAGTTTTTTCTATCTGTTCAACAAATTCATCAGTTAAAACCTATTTACCTTTTTCAATTTACTCTTGAATGTGCTGGTCTATAATTGCCTTATTTTCTTAGCCAAAATCAGGTGTAAAGCTTATGAAGCAGGACTATCTCAAGTTTTGATTCATATCATCTATTTCTATTTCCATCTCATCCTCCTACTTCTCATTCATTTTTTTTTCATCTGATGTAGGAATCTCTTGCTTTTCACTTTCTTCAGATTTGTTTTTTTCTTCTTATTCTTGAGCAGTAGTTTCATCTGATTCTTTTATAGCTTCTCCTAAAATCACAGAGGGTTCGTACATTCCTTCAAAGCTATAAATGAGTTCAAAGAATTACTTTGAACCTTTAAGATGCTTTGTTGTCATCAAGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1504.1 L-2509.7 L-3511.5 S-0409.4 S-3632.8
S-6448.6 S-9555.4 S-12850.6 S-151,253.4 S-24900.1
C-0200.7 C-2319.9 C-42,055.4 C-61,166.5 C-81,179.2
C-10547.9 C-12277.7 C-14523.1 C-16656.6 C-18619.5