Summary
Transcript IDgene_000021719
Gene IDTTHERM_00202840
Length599 bp
Sequence
GCCTCGTTACCATCTTTTATGTTTGCCTAAACGTTATGGGAAATACACTCTACCTTCTAGAGAGAGCCAGTGCAAGTGAGTTTAAGCTTAAGATATTCAAAAGATTCCATCATTTATTTTTCCATTAGAGGTATTTGCAAATAGAAATATTGGCTGAAGACAAGCTTGATAATAGATGAGAACTAGACAGTTATTTTAATCTTATCATTAGGAGCAACATTTCCGACATTTATCTCAATAAGTTCTCCATTATCAGATTTCTCGGCATAGAGTGCAGTTTATCCTTCACTTGTCATTTATTCAAACATCTACTTTCCTTCTTCCTTTTCTACAACCATGCCCGTAATAGTATCCTAATTATAGATGATAGTAAAAGATTCCAAGCAAGTGTCTTATTTAATAGGAATTTAGTACTTGACATCTTTGAATGTTTTTTCTTCTTTGTTGTCAAATTCTTAAGTTATCTTCATCCTTAGTATTTAGTTGATAATATCACATTCATAAGAGCACCCCAGCATCTCAAGCACCTCAGAATTGCCTTACTCAGAAGTACCTTAAAGAACAAAAAATTAATCCATAATTTTAAAGAGAGTCTTTTC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1247.6 L-2245.2 L-3269.2 S-0254.6 S-3297.0
S-6230.4 S-9327.0 S-12497.7 S-15631.6 S-24625.9
C-0130.2 C-2114.3 C-4795.9 C-6357.5 C-8440.9
C-10182.7 C-12152.0 C-14139.3 C-16239.6 C-18235.6