Summary
Transcript IDgene_000021740
Gene IDTTHERM_00204150
Length1144 bp
Sequence
ATATTCAATTAAAGATTTACTATTGTTTACTTCATTTTATAATACACTACAAAAAAACCAATTTAACTACTATTTTTTATATTTATTTAAAATGCTTTTTATTTGTTTTCAATGATTAGAATTTGTAAAAATTGCTGTTTAAGGTTTTCAGACAGACAGCAACCTAAATTATAATATTGAATATATATATCTTAGAATTGTAGCAGATTCCAATATAGAAATTTTTAATAATTTTTACTCATTTTTATAAAGTTTTAAATTGTGTCTATATATTAATTAATAAATAAATAAAATTGCTTTTAATAGATATTACTCTTTCAATATTTTTATTTGATTTTCATTAGATAAATAATTTTTATGGAACATTATCAGAAAGAGTAGGTAGGTGAATGACTATTTCAGATGTATTTTAACAATTATTGTAATGAGGAATGTCTTTTCTAGAACTATATAATCCAAAAGGAGCCAGTCTCGAAGAGGCACATGGTAATTCTTCTTGGATATTTAGATTGTTCACATAGCAGACTACAATGTTTTATGCCTAGTTATTTTTATTAGGTTAGATACGAGAAATAATCCCTACACACCAAATATTATTGGAGTCTCTTATATCTATTTTCATTCCGATTTGCCAATCTGAAATTTACTTTTTTTATCTTTATTATATGCATTCAGCTTTTCTTTTATTGAAATTTTATAATTCTGATGGATGATTACGCTCTATAAACTCCTATATCAAATTGTCTAGTAAAAAACAAGACCTTATTTCTTAATTCTTTATGCTTGAATCGCAAACTAAACATTTATCAAACAATAACTCATATTCTGTAAGGCATGTTTCACAAAAAGCATGCCCACATTTAGTGCTCGTACTGCAGCATATATACTACAAACAAATAGCACAAATAAAATCCTTTTCTAAATGTCTTATTTCGCTTATTTTTTGTTTATGAGCCTATGCTTCTTAACTAAGCTTCTATCTTCTTTCTTTTCTTTTTGTGAACCTAGATTTTCTTATAAATTTTTTCACTTTTAACTCTTACTACTTTAATTCTTCTCCCTCCATTTTCTATATATCTTTATATCAATCAATATATCTATTTATTAATTAATTTATTTTTTTAATCTTTCTATCTTATTTTAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1283.3 L-2215.3 L-3322.3 S-056.9 S-398.1
S-691.8 S-9103.0 S-12115.5 S-15221.0 S-24165.3
C-088.3 C-22,532.3 C-45,970.4 C-68,041.5 C-84,066.9
C-101,165.4 C-12450.2 C-14887.6 C-161,055.3 C-18362.3