Summary
Transcript IDgene_000021889
Gene IDTTHERM_00429650
Length1583 bp
Sequence
CGTCTATTGATGCTTCTAAAGCGTTCTTGACCCATATTTTACTCAGCTAAAATATAATCTCTATTAGCATACTTATAGTCGAAATTGCATGCGACTTATTAACCAATAGTAACTTGTTGAGCGTTCATTACATAACCTCTACCGAAAGTGGAATAGTTGCTTGATTGAGCAGCCTATTAGCAGTTATGTAAATCTTTCAACAAATTTAGGATTGTAGGATTATTTTTATATTTTGAGTTTTTAATTTTGTTTATTATTTCATTTAGCAAACTCTAACTATTTTCAAATTAATTTTTATCAGCTTGTGCTAAAACTGTACCCATAGCTTCACCTGCAATTACTCTAAAGTGATTAATAGCCACTTTTTCATCATCTTCTTTTTCCAAATCTTTCTTCTATACTTCGGTGTTGAGAAATAGCTCTACCATTAAATTAGCTTTTTTAGTAATCTTTTTTTTTCCTTAGTTTAAGGAGTTAGCTTTTATCTTAGCACTACCTATTATTTAATACCTTTATTAGTCAGTTAGCTTCATTTCAAATTAAGGTATTTGTAACTCAAAAACAAAATCTTTACTTCTACCTGCCATTAAATGATTTAATTAAATTTCATATTATTTGTCTTAGATTTTTTTCCACTCTGAACCATAAGTTTTTGATACAGTAATCCCATTCATTAGCTCTGTATTACCAAAATTGACTGATATTTTAACATTTTATGCAACAAATGTTTTAATTCCTGCTAAAATAATAGTAAAAGCATCATCAATTTGAGAAATATCCCTAATAAAATTGAATGTGCCTTGTTAAAGTTGATTTATTTTACTTAGAGTTAAAGAGTCATGATCATCTCCAAAGCCAAAACAATCTATGCAAAAGGGATATTCTATTTTAGATTGATTCATGAAATGCTAAGTTTGTGAGAATCCGCAATTATCTTAACCATCGGATAATAGGAATATGCTAGCTAAATTTTTAGAGTTTGTTCTTTCTTTAATTATATCAAAAGCTTTTTGCATTCCGAAACCTATTTAGGTCCCTCCTCCAGCTTATAATTCATCAACTGTCTTCTATATTTTTTTTTTACTATTTTTAGTTAGTTAAGTTAGTTCTAACAATACTTTAGCTTGGCTATTGAATCCTACTAGTGAAATTCTATCATCTCCTTAAATAATGTGAAGGACCTATAAAATGGATTTCTTTACCAGCTCAATTTTCTTTCCTTGCATGGAACCAGATGTATCTATAACAAAAATTAAATCTAAGGGTTAATATCTAACTTTATCTTTTTTGACTTAATCAGCATCAAAGTCCTTAGCCTCAACAGAAACAACTCCAGGAATAATTTAATTATTCTTTTTATCCATAACAATTTTATTATTTAAAAGCTTAATTGATAGACTGAGATTATCTTTTAAAAAGTAATCTGCTTTAGTTTGATCACTGCCAGTGTCTGTATGTAAACCAGAAATCTGCTCTGCTAAACTTTTATCTTAAAAGCTGTTATCTTTCTTGTTAAAGTAAGGAATATATTACAAAGTATTTCCCATATTGATTTTATTATATTTTAAATAGCTATTTATTTC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1592.1 L-2412.4 L-3696.5 S-02,897.7 S-33,800.6
S-65,316.1 S-95,279.8 S-126,659.8 S-158,320.7 S-249,203.3
C-0259.0 C-2607.1 C-4284.8 C-6219.1 C-8200.6
C-10114.5 C-1280.8 C-14123.5 C-16293.9 C-18535.8