Summary
Transcript IDgene_000022009
Gene IDTTHERM_00155590
Length2471 bp
Sequence
TATAAACAGAAATAAATCTAATTGCATGCAAAAATATGAGAGTTAGTTTTTATAAAAGAAAACAAAAAAATGATAAATATTTTAATTTTATAAATAAATATGAATTATACTAATAAGATAAAATCTTAAAATTTAATTTCTAATCAATTTATCTTAGTTTAAAGAAAATTTATAAAGTTTGTTTGGGTAATTAGTGGAAAAATATAGATAGGTAGATAGTTATTTAGTTTGTTTTGTAGTTTTCTTTTATATTTTTAATTTGTGAAATCTCAAAAATGTGTGTTGTTATTTTATTTATATTTATATTTCAAATAGGTTTTTAGTTACAAATATTTTCTTTATTCCTCATTTATTTTTTTATGTTATCTTTCATTGTTCAGCATTCATTTATTGTAAGCCATTATCAGCATTTTAAACAGCATGAGTATCTTAAACTTAGCTATTATGAATGGAAGCAACCTTTTATTTAGAATTCTTTTAAGAATCAGGTTGGATAGTTGCAATATCAGCATGTTGATGGGTATTTTTAACTTAAGAAGAACTCAAAGAAACATTCACTTTATTAGATTTTTAAGAACTAACCATGTCGGATTGTTAATTTATTAACTTTTGATCTTCAGATTAAACTTTGTCATTGAGATTTGATGCCTATCTTGAAACGACATGGTTGCTCATTTTTGAAGATTTAGAAGAATTATGGTTATTTTTATGTTCTTAGACTTCATCTTAGCCATCATGATTCTAATGTTATTCCTTTTTAGATGATTTTTAATTTGAAATTGAAGCATGTTCATCCTTGCTTTTACTTTCATTCACTTTTGATTTAGATTTAGAACCATTTCTAGATTTTGATTAGGATTCTTTTTTTGATTTAGAACTACTTCTACCTTTAGATACAGATCTTTTTCTAGTAGAACTAGTTTCTGCATGCATTTACTTAGAGCTTCTTCTTTTAGATTTAGAGTTATTTCTTGATTTTGACTTAGAGTTGTTTCTAGATTTTGACTTAGAATTGTTTCTAGATTTAGATTTAGAGTTATTTCTAGATTTTGCCTTTGAATTGTTTCTGGATTTTGATTTTGAATCACCTGCATGTTTAGACTTAGATTGAGCTTATTTTGAATCTCTTCTTGATTTTGACTTAGAATTATTTCTTGATTTCGACTTAGAGTTATTTCTTGATTTTGCTTTTGAGTTGTTTCTTGATTTTTATTATGAAATATTTCTAGATTTAGAGCTGCTTCTTTGCTTTGATTGAGAGTTTTTTCTAGATTTAGAACCTTCTTTTGCTTTTGAGTGCTTCTTAGAGGATTTGGATTTAGACTTTGAAGAACTTCTCTAGACATTGTGTTCAGTTTCCATAGATTTTTTAACTTAAGACCTTCCTCTTGGCTTAGTGGCTGATTTCTCAACACTCATTTAATTTCTCTTTTTTTGAGATTATTCCTGTCTTGTCTTAGACTTTGAATTTGACTATCTTTTTTTTGAGGAGTTATTTCTTCCTCTAGATTTGGATTTAGAACTATTTCTAGATGTATTTTCAGCTTCCATTTTATTTGATTTTCTAGGCATCTTTACGACTTTTCCTACTTGCTTTGATTTTGAGTTACTTCTAGATTAATTTCCTTTTGATTTAGAAGTTGAATTTCTTTCTTTCTACTTAGAAGGTTCTTTAGATTTGGAATTTTTTCTTGACTTGCTTGATGATTTTTCAGCTTCCATAACTTTAGTGTTGTCAGTATGCTTTTCATCAGTGTGATTCTATTTTCTGGAATTTCTATTATTCTTAGATTAACTTCTTTCATTGTTGGCTTTCTTTTGGTCTTTAGATTTAGAGTTAGAAGAATTTCTTTTAGAAGAGCTTGATGAGCTTCCTCTACTCTTATTGTTAGATTTGTTCTTAGATCCACTTCTATTTGTTGCCTTCTTTGCGTCCTTGCTTTTACTAGCTGAAGCCTTCTTTTAAGAGGCCCTTGCATTTGATCTGGAACCACTAGTAGTTGATTTTGACTTTTTAATACCTTTACGATTAGGAGTAGGATGACTATCAGCTTCCATTTCTTTTACTTTATCAGTTTCTTCTTCTTTATTTTATTCTTCATTATCAGCAGGAGCATGCTACTCATTCCACTCTTTTAAGTGATGTTCATACTCCTCGAGAAGCTTCAAGTGTTCGTCCTCATACTTTTTCTTTTTTTTTTCTGATAAGCCATTCCATTATTCTGAAATCTTTTCATTGATTTTAGAGAGAGATTCATCAGGTAAATCTTTCTAGATATCACTTAATACTTCATTCTTGAATAAAAAGAAAGGTCCTTCAGGTTTAACAGGCTTTTCTTTTTGGTTAGTCTTCTTCTTTTGAGTTTTTCTTTAGTGGCTCATTTCGTAATTAATAGCAAAGGAATGAATGATATTAGATTTTTTGATATTATTTTTGGATATTTTTTAATATTTATAAAATTTTTTGTTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,474.3 L-22,157.8 L-32,944.5 S-0367.4 S-3991.6
S-6286.5 S-9194.1 S-12172.2 S-15116.2 S-24128.6
C-053.1 C-256,069.9 C-447,584.6 C-628,431.7 C-818,753.0
C-1011,800.3 C-1222,682.2 C-1417,627.1 C-165,645.8 C-182,839.6