Summary
Transcript IDgene_000022047
Gene IDTTHERM_00703410
Length739 bp
Sequence
GTTGATTGAAAATGAAATTTAAATTTGTTAAATTAAAGAAATTGCCACATTATCTTTAATTTTTCCCTCACTAATATTAGACAAATTTATTATCCTTCTTAAATGAGGGTGTTTTTCATCTATCCAAATAGGAATGGCATGTACAATAACTTAATCTAGCACATTTGATTAGATACCTAGATTGTAGTGTTCGCTTACTCTTTTTATTATTTGACACTAAAAGTTAGGTTAATACTTTTGCTTTTCTTATTCTTTTTATTCATGTTATTATGACTATTCTTTATCAATCAACTCATTATTTTAACTGGTATTTTATTATTATTTTATTTTTTCTTATTCTTCTAATTGTTGCTTTTCTAGTTCAATTTATCTTTGTCTTTCAATTTCTAATTATTTTTACTTTTCTGCTTCAAGTTTTTACTTTTCAAGTTCTTCTTATCTTTTTTTTTCAAGTTCAATTTATTTTTATTTTTCAAGTTCAATTTATTTTTATTTTTCAAGTTCAATTTATTTTTATTTTTCTAGTTCAATCTATCTTTGTTTTTCAAGTTCAATTTATTTTTATTTTTCAAGCTCCTGCTATCTTTGATTTTCTAACTCAATTTATTTCTACTTTTCAATTTCTTCTAAACGTTTTTTTTCAAGTTCAACTTACTTTTACTTTTTAAGTTCTTCTTATTTTTAGAGCTCTTATTAATCTAATTAATCCTAATGTGAATTATCTTAATTCTTATTAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1497.5 L-2591.5 L-3409.8 S-0389.1 S-3239.6
S-6218.2 S-9161.4 S-12133.3 S-15262.3 S-24225.9
C-0332.7 C-2160.5 C-4113.8 C-6659.7 C-8331.7
C-10292.0 C-12296.4 C-14237.2 C-16154.3 C-18245.2