Summary
Transcript IDgene_000022175
Gene IDTTHERM_00149000
Length457 bp
Sequence
CTTTATTGTAGTCGACTAGAATTTTGTAAGCGAAATAACTAAGAGGTATAGCATTTAGTATAGTAAAGCTACTTATTTTTGTAGCAATGCTGTGTTAACTGCTTTTAAAAACGAATTAATATACAAACCAATTTATGCCTCCAGTGTATAGACAAACTGTTAATCCTTATTAACTTAATTTTCTTATATATTTTTCTCTATAAAGTAGTGTTTCTTTATCAAATTCATATATGTATTTTTGATCACCCTTAAAAAAAGCTTCAAATAAACTTTTTTATTATAATTCTAAAGGCTTTAAATGAATAGGTTTTGTTTCTAACTTTGGAGTAGCTTTATACAATTTCTAACTTTTATAGATTTCCTCAACATCAATTAGATTACTGATCATCGTGTCAGATTTTAAAGAGTTACCTGATTTGTCTTTATTTTATTCGCTACTCATTTCCTTTAATTTTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1573.0 L-2441.9 L-3273.0 S-054.4 S-341.0
S-661.7 S-953.7 S-1246.3 S-1541.3 S-2444.6
C-057.3 C-273.1 C-4129.7 C-6671.4 C-8555.8
C-10181.9 C-1280.8 C-1458.8 C-16108.8 C-1856.8