Summary
Transcript IDgene_000022342
Gene IDTTHERM_01050690
Length1148 bp
Sequence
TGAGTAATTATTATAGACATTGCTAAAAATGTATTATTCATTGATTAATGCATATTTATATGTATATACATGCATATGCACATACTTAGTTACTAAAAAATTTTACAAATTATTTGCTTATATTACTTACTTACTATTTTATACTGATAAAAATCATTTGCACTATTTTTCCATCACTTTTCAGCATTGAAACCATTTTTTTCTAAAAGAGCTCTGATTTCAGCTTCTTTGAGGGTACGTCCTTCTATTTTTTTAGAGGTTTTGTTTTCGCTAATAACAACCATTTCAATCTTTTTAGGAGAGGGATTAGCGGTATCCATAGTTTTAACAAGGGCCTTGATACCTAAGTTGATACCTTCCTCAAGGGTGATATCAACTTTATAAGATGGCTTGAGTAAACCGTTGGCTTCAGCATTCTTTTGACCGATGGCGATAGCTTTCCAGCCGAAATAATTACCAGAGGGATCAGTAGAATAGAGTTGATATCCTAAATGACGGTCGTGACCAGCGAAAAGGAAGGCTGCACCGAAAGGTCTCAAACCTCCAATTTGAGTATAAGATTACTTAATATCGCAGATCTTAACGATGAGCTATTCGATGGGGATATTTTCACCACCATAATGATATTTGTAGTTTTATGCTTCGACTCTAGCAATGTCGATCAAGTAATTTGCATCAGCGGTTAAACCGTTGACAACGGAGTACAAATGAGAATCTAACTAGAAAATCTTTTCGGAATGAGTAGGAGCTTCCAAAAGAGAGCTTACGTCCTAACGCTCAGTAGTTAAAACAATACCTTCCTTTGTTAAAATACCAATAGCACTGCCAGTTTTGTTAATAGCTTCAATAGCATATTAAACTTACAATAATTTACCATCATTAGTAAATGTAGTAGTCTTCTAATCGTATCTTCTTGACATTTTATTAGATGATATATTTTTTTCTTTCTATTTATTCTCTTTTAATAATCTTTCTTCTTCTAACTTTGTAGTCTTCCCTATCTTGCCCTTAAATCACTTAAGTCTAAACAAACTAAAATTTGTGATAATATGGATCTTAATACTTGTTGTAATTTATTTATTTATTTATTAAATTAATAATTATTTATTTAATTTAGAATGATCCTTTTTTTTTCTAATCTTTATTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-114,570.5 L-217,259.7 L-316,726.0 S-021,357.6 S-310,232.1
S-69,996.4 S-99,741.0 S-1210,235.4 S-1511,605.6 S-2410,108.4
C-05,049.3 C-23,365.0 C-44,652.8 C-62,777.3 C-85,104.4
C-105,419.5 C-125,196.0 C-145,674.3 C-166,168.9 C-185,686.4