Summary
Transcript IDgene_000022743
Gene IDTTHERM_01099200
Length889 bp
Sequence
TCTGAGATAAAAATACTAATTATTCTACCAAAATTAAAAAAGATAAAAAAACAATGCTGATTTAAAAATTTATAATTAATTAATTAAGCATGCTTGATTTTTATTATTTTAGATCAAATTGCTTTTAATATTAATAAAGTTATGCAGCTTTCTGTAGATTTTAAATTATAGGAAGCACAGACTTCAGTAAAGGCATCACGATCATTGAGTTTAACAGTTTCATTAATGATAGCAGGGCCATTTAAATTTAAAATAAATATATTTTTCAAAGATTCATTCTAAATTGTAATAGTGTTGTTTTTATCAAGATGACAAATGCTCAATTCAATATTATCATTTTAAATAACAGTTTATAATGTATTTAGCTACTTTCTAACAACATCAAACTAGTAGGTAGCTTATTCACCTTCCTCTTTTTAGAAAACTTAATCATTTTAGATCCAAAATTCAAATATTTCTCCTTGTATATTTTAATCAACATTTTATATTCCATGCTTTATTTCATTAGGTCCGGTTCTTAAAAGATGACATTGACCTCTTTCGATTGGTACTCTTTCTTTTACTGAAGAATTATGTCTAAGACTACCATTCATAACAAGAGTAACAATATCAAAGTTTTTGTGCAAAATATTTTTTCCAAATTCTTCTTATGGATTCAATTAATATTCATTGACAGCTTTAATTCTACCTACTCCCATTTTTCTGGGATTATAATACTCTCCAAAAGTAAAGTAACAAAATCCTTTAGCCCAATTGTGTTCAAATTTATATCTTCTATCAGCTCTTTCCATTTTATATGTATGCTTGCTTATGTATCTATCAATCTATATAGCTATTGACTATTTAGTTTTGAGTGTGTATTTTTTTTAACCTAATATATAATAAATTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,826.6 L-21,835.5 L-3984.0 S-0799.4 S-31,913.9
S-61,021.9 S-91,054.1 S-12559.8 S-15857.9 S-24532.2
C-0707.7 C-2194.1 C-4827.3 C-62,654.4 C-84,544.2
C-104,065.5 C-122,418.6 C-14807.2 C-16658.9 C-18632.6