Summary
Transcript IDgene_000022815
Gene IDTTHERM_00297170
Length487 bp
Sequence
GTTTATATATATAGTTTAATCCATATATGCTAATACCAGAACTAGCTATTAATCTTAAACTATTCAAGCCAAGTACTTTATCTTCTAGATACATTTCTAAGAAAGGGGCTTCGATTCTTTTAAGAAATTTAAAGAATATGAGACCAACACAAGCACATCCTAAGAGACCAAAATTTAAATCAACAAGCTAGCTAGTGATGATTCTACGGTCTGCAGACTCATGAATTTTATCTTTGTTGAAAAATGACCATTTTAAGAATTTTAAATTAACTTATCTTCTATATGCTTCAATTTAAGAATTAGTCATTGTTTCATATTGATCAGGATAGTATATTGCTTTTTTATAATTTTAATCAAGTTTATTTTTATAATAGACATATGTGGTGAGGCTCTCTCTATCAGTATAGAAGAATAAATCTTTTTTAGGTAGCTACATTATTCAATAAATATTATCTATCAACTTATAAATTTACTAATACTTGCTTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1791.4 L-2720.4 L-3579.8 S-072.6 S-357.0
S-666.9 S-973.6 S-1270.6 S-1575.1 S-2484.1
C-0103.6 C-2181.7 C-469.2 C-639.9 C-858.2
C-10166.7 C-12144.7 C-1481.0 C-1645.0 C-1836.9