Summary
Transcript IDgene_000022911
Gene IDTTHERM_00294550
Length1994 bp
Sequence
AGGACAGGTCAATAGATTTATTTTTACTGATATACATTATTATTAATATTATTATTTTTGTAGTATGCATGTTTAAAATTTAGATTAATTGTTTTTTAGTAACGAATTAACTTTATTTTTCAAATTGATATCAATTCCATATAAGTAGGTTTCCTCTGCTATCACCAGAATACAAATTACCAGAAACATTATGATAGTCCACTGCAACAATAACACCTTAGTGATTCTAATTTTTAAGAACTGATTTTTTAGTACCATCTTTGAAATTAAACATGATAATAGAGCTGTCTGAACTTCCTGCAATAATATACTTATCATCAGGTCCAAAGCAACATTTGTTAAACTCATGATTATTAAAGTACTATTGATTTTCAAATGTTTTGACAACCTAATTTTTACGTAAATCAACTACTTTTAAGGTAAACCCTTCAGCACTTGAAGCTAAGATATAATTCTGACAATTAGAAATTTTAACACATGTAACTCCGTTTTCAAATACACCCTATACATTATACACTGGCTTTGTGTTATTAGAGTCACGAATAGAATATAAACGTATTGAACCATCATTATGACCAGAAACAATATGAGGCTCGCTTTAAAAGTAATCAATAGCTCTCATAATTGATCCACACAAAATACTTTTAATTTAAGAAACTTTATTTACATCCCAAATCTTCAAACTTCTGTCTGTAGAACCACTTACTACTTTTTCTTTTTCTGAAGTAAATGAAACAACATTAACTCTTTCATTATGTCCTTAGAATGTAGATTTAAGCTTGCTTGTAGAGTAATTAAAAAGTTACATTGTTTTATCGGTGAGACCTGCTAGTATAAGCTCTGAAAAAGGAGCAAAATTCAAATGAAGAAATAATATATCATCTCTTGGAGACTGTAACTATCCTTACTGATTCATACTAAGTGGATCATATAGCTTAATAAAATTATCTCCACCACACGATGCAATTAATGATCCATTTAAAGACTAACCAATGCAATATATCTCGTTTTTATGCTATTTTAATAGAACTTTAGTAGGTTTCGAAGGAACTTCACTCTATTAAAGATTAATCTTTGATTCATCAATAGTTGGTGCTAATGTAGGCATTTTTATACCACTCTTCTAAATTTCCGTTTAAAAATTTAATTTACGTTTAATGAGGTATTCTTCATCCTCTGATAGCTTACTCATCTTGTAATTAAGTTCTTCCTACAAAGTATTTAATTAATTCATTTTTTCTGCAAACTATGTTTTTTCAAGTAAATATCTTTCTAATAATTGATTTCTATCTGCTTCAACTATAGTAATTTATTCTATTTTTTTTTCTAATTAATCTTTTATAGTTTGTATAGCTTCTACATGCTTAATTTCTATTTCATTAAGCTTTTTTATTTCTGCTGCCTGCTTAGCAATCAAATCATCTTTTTCATAAATATTTTGCTTTTGCTTAGAATTTTGCTCTACTAAAATATCTAATTAGTTTTTTAACTCCTCAAGATCGTGGGATTTAACTTTTAGATCAGCAGATAGACATTCATTTTGCTCTCTTAGCTAATTGCCTTACTATTCTAATTATTTTACTTTTTATTTTAACTAGAAAATAGTATTCTATGATCCTGGATTTTATTATTAATACTGCTAAGGAGGTGTGCTATCTTTTTTTTAATAGTTTTAACTTAATGACTTTGATCTTTCCTATAATTGGTTTTGGGTATCATACATGTCTTAACTCATTGAAGGACTTTTGTTAAAATAGTTTTCATTTGAATCAAGTTCTAATCTGTAATCATCTCTCTATATAATTTCATTGGCTCCAAACTAAAAAAATTTTTTAGATTAATTGTTAAAGTAAGTCATGCCTTATTCATACAAAGTGATGACTTCATCTATTTCTTTAACTTTACCACTAAAGCTTCTTAATTAATTGAGAATTTGATTTTAGTTAAAAACTTTTTTTTTGATAGTTGTAGACATCTATTCTTACTTTTAATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,001.8 L-21,167.6 L-31,086.5 S-01,760.0 S-31,443.4
S-61,131.1 S-91,151.4 S-121,400.5 S-151,514.5 S-241,284.4
C-01,151.2 C-2734.4 C-4776.0 C-61,281.3 C-81,988.2
C-103,008.2 C-121,729.3 C-141,727.0 C-161,662.1 C-181,587.4