Summary
Transcript IDgene_000022925
Gene IDTTHERM_00293300
Length435 bp
Sequence
ATAAATTAGCAAAAATGATTAGAAATTTATTAAGAATAGGAAGAAAGGGATTTTGCACTTAAGCCACTGCTGATGCAGCAAGCAAAGTAGCCTTTAGCTAATCTATGAAGCCAAAATGGATGAAATTCTTTGAAGGATAAGAACCTATTAAAATAGATCTAGAACGTTCGATGAAGTCTGACAATATTGATTTAATTTAAAATTACATTAAGAATAACTACCTCTAATTTGAAGATTAGCAACTTGTATAAGTTATTCCCAAAGTAAGCAGAAGTAATATTATAGACCGCGTAAAAAATGAAATTAGAGTGAGAATTATTTAGAATAATTTTAATTTGAATGTGAGCTAAAATTTTACTCTACTTGAGTATATGGAAGATATCAGTTAGGCAGATCGTCTATTAGTTTTATATACATTGACTAAATGCAGTGAGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1414.1 L-2347.4 L-3191.5 S-044.9 S-333.6
S-629.6 S-939.7 S-1243.6 S-1548.3 S-2441.8
C-041.3 C-231.6 C-446.5 C-632.2 C-833.3
C-1036.4 C-1237.4 C-1428.2 C-1638.3 C-1831.9