Summary
Transcript IDgene_000022945
Gene IDTTHERM_00586851
Length3092 bp
Sequence
CTATAATTAAAAAAAATTAGTTAAGTTATTATAAAATTAGAGAAAATACAGAATATATTTTTCAAAAATTTTATTTTTAGAAATACTCTTAAGCTTTATTTGATAAAAATTCAGAGTAATGTTAAGTCCATTCATCAGTTTATTTCACTTTTGCTTTTTGGCCATCTAAAATCCATTTTGATATATGTTTATATATATTGCTTTCTGAGTAATATTAAGAGTCTAAGAAAAAAATGCAACCCCAATCATCTTTGTAGCGGATACATCTTCCTGCAGATTAGTTGACAACCTTCACAGTCTCTTTTTTATACCATTGTTCTTCCTTTAAATAAAGCTTTGCATGAGTTCTTTTACAAACTACATATGGATCTGTAAAGCATGGATATGGAACTCCGAAAAGGATAACTACTCTGCATAAATTATCTTTTAAATCAATACCTTCAGAGAGTTTACCCCTATTTACAGCTAAGAAAACACAATTAGTTCGATTATTTTGAATAAGCTACTTATATTAGCTATAGATTTCTTTAAATTCATTCGCATCTCTTGTTTCTACAAAGTATCGAAAGTCATTAGATTAATAATTTTTAATCAAAAAGTAGTATTGTTAAAGCATTGAATAACTCTTGAAGAAAATAACCATTCCCCCTTTTTATTTTACTTGATTAGTATACTCATTAAATTTATTTGTAATAAAGTGAATTGCTAACTAAGAATGATAAAAAATATTATTTTTATTATCTTCATTTTCAAGTTTTTTCATACTGAAGGAAATCTCTTAATCATTGTAGTGGCTAATAAATTAAGTAAAAAGATTTGTCTACGAATTAATTATATGAGGAGAGGAATATGTTTAAAATTCTAAATCTAAAGATTTCTATATTAACTCAAATGGTTCTAGTGTACCTGAAGTCAGTATTAAAGAACTTATTTTTAGCTTTTTATAAATTTTTTTAAAAAGATATGAAGCTGATAGACAACCTATTTATAAAACGGGCACTAAAGAATATTCTCCTCTAAGAAGTGAAATATAATGGTTTGATAAATAAATAGGGTCTTCTGAGTAATTATACATCTTTCTCAGTTTTATTAGTCTATAGAAAAAGAACCATATTTTTTATATATATTTCAGCTTAAGTTGCTCTCCGAATTTTTTTAAATTATTTAAATCATCTTAATTAGCTTCATATATTTAATTATTTTCGGCTACAAAAATATTGCGTTGAGCATCACTTTTACTTTTAGATTCTTTTTTTTCCTTTTCTGTGTAAACTCTAATCACTTTTTTTAAATATTAGAGCATGGTAAACATTTTTGTTAACCTATCAATAAAATTTTCAGCTTGTTTAACGTCAACTACATTCAATAATTAAAATTATTTTGTAATTTCTTTATCTGAAAAAAGACAGCAAAAAGGTTTAACATCCTTTTAATTTTTTTCATCAAATATATATTAAATGTTCTCACAATCTTCTTTTATGCTTAAGAAGTGACCCTGAAAATTGTTAAAAAAATCCAATATTTCTTTTCTTCTTAAATCTTAATAAGATGCAAATGTACTTTCCATTTCAACAATTGTATAATCTTTATTTTATTTAATATCTTTTATGTACTATTAAATTTGTTTAAGATTCTCATCCGAATTTTATGGTAATTCACCATTATTAAAAATTATTAAATTTATTTTATCATAAATATCTTGAGAGGAAAACTGGATGTTTTAAATAAATTTCCTTTTTGATTGCTTTTAATCCTCCTGGGATACCTATTTAATGTATTTTACATGCTTAAATTTAGGAGAGACTTTTTCCACATCATCATCATCTTTATCATTTTGTTCTTGGCTAGAAGAATCTAAATCAGACTTATCACTCTCTGTATCTGTACTTTCACCCTCAACTATTTTTTTTTAGAGACTAGACATGAAATAATTAGCTTCTTCTTAAATATCTTTACAAATTATATCTTGAACATTTCGATAAAGATTATTTAGATTTTAGCTAGAATAATTATTTTTGTTAAAAACTCTTTATACTTATTGAAGAGTAGTATCCAATTAATCCCAATATTTTTATTGCATTTTAGTACTTTATTCTTGCTCAGCTTACTCTGAAATATTATGAGCTTCATCAAAAATTACAACTACTTCACCTTCAAAGAGGTCTTTAATATTTCCTAATATATTCTATTTAATAAGATAGTTGTATGTAGAAAAAACCAATTTAGCAGAGCGTGTTGCTAGTTTATTAAAATAAAATGGGCACCCTAACTCTTATTGTTCGAATAATTCCTTCATGTCTTCAATATCAGGCAAATTATATTGTTGATTATAACCTTAACTTACAAATGGAAAATGTATATCCATTTTTAAATTTTCTTTCTACTTCTTTTTTAGAATCTTTTTGTAAATTTTGAAATGTGGGCAACATGTGCACCCTAGTTATTCCCTTTAATCTTAAAATACTCTTTGATTAATATTTACATATTTATTTTATGCAAATAAGCTCAAATCAGGAGATTACATAGCTTTGTGGGTTTCACAATTAGTTCTTTTACATCTATCATTACATTCTTTAGTAAGATGTTTATTAAATTTAGATTTTTTTATTCCTTGCTTTTCAAAATCTTTTTTAAAATCATCAAGATTTAAACAAAACTAATTTCTTCCAGCCAAAATAGAATACTTGCTTATCTTTGGATATTTATTAATTTTTCTTATTTCTTTTATAAAACCATTTATTTATTCATTAGTTCTTGTTAAAACTAATACCTAAACATTAGGATTCTTCTCAGCGTATGCAAGAGCAGAACAAATAGTTACAAGTGTTTTACCTGTTCCTGTTGGTGATTAAAATAGCAGATTTTATTTTTCGCATAGCGAATTTATAATATTTTTCATACATTCAATCTAGACAGAATAAGGTTAAGGATATGGAAAGATTTGCAAACAAATTTCGAGTATTTACTCTTTTATATCCTTTTCAATGTACATTTACTAATCTTAATTTTATTAGGCATTCATTTCATACCCAATTATTATTTTATCTTTCTTAACCTCATTTTATTACTCTTTATTTTATATTATTTGCTGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1355.7 L-2397.1 L-3550.0 S-0185.3 S-3702.3
S-6561.5 S-9512.7 S-12268.4 S-15344.3 S-24329.6
C-0392.5 C-23,076.4 C-41,148.0 C-6739.3 C-8649.0
C-10556.7 C-12921.5 C-141,047.1 C-16801.9 C-18701.0