Summary
Transcript IDgene_000023060
Gene IDTTHERM_00577050
Length475 bp
Sequence
TTGTTATTAATAAAATATAAATACAAATTTATTAAAGCATATGTTTGTTTTCATGATTTAATTTCGATTCTAGATACTCAAATTATTATTATTTATAGCATAAAATTTGAAAATAACTTCATTTTTTAAATGCAAGAAGGATCCACCCTAACATCATAGCCATACCACCGTATGGGGGAAGTCTTTTAAAATCTTCATTGTTTGTAAATGTTTTATAATAAAGAGATCCGCTAAAGCAAGTCACTCCTATCAAAAAAAGAATAGTGGAATAGTTGAATGGGTTATTATATGACCCTATAATCATTCCAGTATTTGAGATAAAATGATAAAATGTAGCTTTTGTCAACAAGTCTTTTCTCTCTTAGGTCCATTCCTTTTTATGACCTCCTGCAGCACCTATACCAATACCTAGAACAGTGCTTAAACATCCAGCGATATATGAAAAGTTCATTCTTTCTTTTAATACTAACCAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1605.7 L-2546.7 L-3570.7 S-0236.9 S-374.2
S-678.9 S-944.1 S-1240.9 S-1539.9 S-2447.4
C-077.3 C-253.2 C-477.8 C-643.7 C-834.0
C-1063.6 C-1269.5 C-1464.4 C-1662.8 C-1842.1