Summary
Transcript IDgene_000023075
Gene IDTTHERM_00576900
Length1341 bp
Sequence
GCAAGATATATATAAGTAAATTGATTATTATTTTGATAGATTAAAGTATTAATAATTTATTAGTTAAAGAAATCATATAACTTGCTTAATAGATTCTTTAGCAGTTTTTATCATCACCTTTTATACAGCAAGTTAGTTTATATTTCTATAAGCACCATTTACATTTAGAGCAACTTAAACTCCATCGTTGACTATTTCCGCTGCATCATCTCCAAATTTTTTTTAAACAACTTAGGTAACAGATTCATTTATTTATTTTCCTATTTTATCTGCTGCTTGATCAAGGTTATCTAAAATACTCGAAGTAGCTTATAACGATGCTTAAGCTACACCTCTTAGATATTAAAAACTTTAATTTTAAGTTTTTGCAGAAGGTCCATCTATTTTATTGGTTATAGCACTAATCGCCATAGAACTTATTTTAATAGATGCATTTATTATTTATGAAGCAGCAAGGCTAGTTACCTCAATAACTCTACCACTGAAGGTTTTAATTAATTTAATAGCATTTTTAGTAGAATTACTAACTTTAATATCTTTGTTTTTTTTTATTTTTTTCTCAAAAAAATTACCAGTCATTTGAATTCCTGAATGCACTACTCCAGCACCAACTTAAATCCCTTTGCTAATAAAAGATCCTCCCAATCCAATATACTTTGCTATTGAATTACTAGATTATGGATTTTTTTTATTATCTTCTTATTAGCTATTTTTTTATTAAAGTTCTTGCGATTGTTAAACTAATTTCATTTATAGTTATTATTCTTGAATACTTTGATTATTCTTAATTTAATCATTTATCATTTCAACTTCATCATTCCCTTAAGGTGTATGGTTATCATAGCTTTTATCATCACCCATAGGAGTCTAGTATTCTTAAATTTAATTCTCACCTTCAGGAGTTAAATTTTGCTCACTACTTTTGAGAAGTATTTGAGATTTTCTAATACTATCTAGCTTTTGCTCCTTTTATCCTTAATTGTAAATTAGATTAGATAAGCTTGAAAGAATTTAATCTAAACAGTCATAAATATCTTCATAGTTAGGTGTATTATTACTCAAAAGCACCGCATAATTTACTTAAATACAAGGGAAAATATAACTGCGATGAGTTTAATAAGCTGTAAGATATATTGGAGTTTCCTAAAAAAGCTAATATTGAAAATTATTAACTTTAATGAAGATCTCTTGTTATTCATTTTATATCACTTGAAGAGTATCATTCTCAAAAACTGTCTAAACATCTCCTTTGTTAGGTACTGCAAGTAGTTAAACATTTTGCACTTCATAGATAATTACATCTTAAATTTACACAACGTCAACCATATTATTAGCTCTTTG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1578.0 L-2550.9 L-3751.8 S-03,291.4 S-31,726.3
S-62,032.2 S-92,042.7 S-122,692.5 S-152,942.4 S-243,462.0
C-0272.9 C-2205.5 C-4282.1 C-61,323.4 C-81,107.5
C-10797.2 C-12301.7 C-14502.6 C-16675.3 C-18717.8