Summary
Transcript IDgene_000023115
Gene IDTTHERM_00112450
Length1712 bp
Sequence
AAAATAATCAATTAAAGATTAAATAAATATGTCTACACAATGAAAGTAGGATATAAAATATAAAAACATTAATTACCTCTATATAGATATTAAAATAAATTATGATAAATTGTTTAGTGTATTTAAAAATAGAATGAGTTTTATTATTAATTAATAACTTTTTAATTTTAGTGTGTATTTCTTAAAAACATTCAATGTTATTATAGTTCTTTATTATTAGATTTGGATATAGATAGATAAATAGATGACAGATTTACTGATTGATTGATTGATAGATTGGTAGATTGATTGATTTATTATAGATAGATTAAATTATAATAATAACTATTGTTATAAAAACAATTAATTAAGTAATTAATATTATTATAATACTAATCTAATTCAAATCATTCAATAGTAATAACCTTGATTTTAATTGAAATAGTTGTTGTTATTGTTGTTATTATTTTACTGATAATATTAATTGTTATTGCCATTTTAGTAATTCATGTTATTTTATTAGTTCATTACATTCATATCTTACTATTGCAAGATTCCTTAATATTATTCGCCTTGGTTAGTTTTAATCTCAATAATATTTGCACCTCTTAGTACTGGGGCCATACTCTGTTTAGATTAAGATTTAAACTAAGATATCATAGATTTGCGATTACTTTAAACAAAATCTTTGCTCTTTGATTTACTAATTTTGTTAACATGTTCTTCATAGTTTTCACGTATGGTTTTCTATTCTTCTTATGAAAGTACATTTTACATCATGTTGATGTAATTTTAATTTCCGATTACTTGTGCCATAGTTTCCATTACATCTTTAGACAAAGCCTTAATAGAACTACGAGAGTTTGATATAGTTTGAGTCAATCCTTTCATAATGTAGCTAAAAGTTTAAGGCTAGAGCTTAGTTAAATTTTCTTTAGCTTCTAAGATTAGCTAAGAAAGTATTTTCAAAGCTATTTCTTAGACATTGGGATTTTTATGTATAACTGCTGTTTTGATGATGACAACATAGGCTGAATCATAGTGACTGCAAGTCTAAGTAAAAGTAAGAAGAGCATTTTATGCTGGCTAAGAAATAATTTTTGACTCGTCTATAGACTTCTAAAGCAAAATAGGAGCAAATTTCTCAATGACTAAATCATTTAAAGGAGTTATTTATGAAGACATAAATACTTCATTAATGAATAGAAGAGTGTTCTTGAGAGTACAGGTCTTAACTCCTTCGATATTTTCTAAAATTTACATTCCGAAGTTAGAAAAGATTTGATTTACATGCTAAGGATAATTCTTATTTAGCACACGCATGTGAGTAATTGCATCAAATTGATCACGCCAATTTTACTTGGAATTGATTAAATTTGTGATAATTTCTCCAACTTATTAGAGGTTTGTACCTTCCTGATATTCAGGAAGTTCTTCTCTTGTATAATAGACTATGTTATTATTGTTGTTTCCGTAGACCTATTAATTCAATTATTAATTATCTTGATACTACTAGTTGGTATTTTAGTTATTAGGAAAAAAGCTGTTGTCCATTTTGATAAGCGTACTGTTATTATTTAAAGAAAAGTGTTAAGATGTATTATTAAGAGTGGTAGTATGTAGGGATTTTGCAGATTATTCTTCTAGTTTAATGGAACTTATTTAGTTCTTAGATGGATTATATAATTTTGAATTTATTATTTCGTATGAGCTAATTTATATGTAGATATTTG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1705.7 L-2576.1 L-3704.3 S-0345.7 S-3902.0
S-6903.7 S-91,019.9 S-121,273.8 S-151,413.7 S-241,268.9
C-077.2 C-25,817.5 C-46,950.1 C-64,085.7 C-81,192.8
C-10627.5 C-12985.8 C-141,492.1 C-16950.7 C-18874.1