Summary
Transcript IDgene_000023175
Gene IDTTHERM_00120930
Length955 bp
Sequence
CTATTATTGAATAGCTTTAAAGATGATTTTGGATGTAGTTAACAAATGCTTGTTTTATGTTCAATGCTCAGCTTGTAAGGTTAGGTATTTTACAATGGATTTGATCCAGCTACTATTTTGAAATAAAAGAAAAAATTAGGAGCTAAAGAAGGTGATCATATTACATTAATCAATATATTTTTAGCCTTTAATCACCTGAAAAGCTCACAAGCTAGACAAGGATTTTGTAGCGATCACAAACTAAATATAAAAAGCCTAAATATGGCAGTTAAAATACATGATTAGCTTTGCAAATAAGTTAAAAGAATGGGATTGAAGGTTAACAATAGTGAAGATGATATTGAGGGAATTTTGAGAGCTTTAGTTACAGCTTTCTTTATGAATGTTGCACAACTTTAACCTGATGGATCTTATAGAAATTTAAGAAATAAAGAAATTCTTTATCTTCACCCTACTTCAATACTTAACATAAATTTTCCTCAATGGGTCATATATTCTGAAGTTGTATTTTCAACAAAGTATTACATGAGAGAAGTTTCTGAAGTAGATCCAAAATGGTTGCTTGAATTAGCCAGCCATTATTTCGAAGATCAGAGATTAAAGTAAGCTGAGTAAAAGCATGGTAAAGAAATCATAGCACAAAATGAATATGAAAAAAACAAATAAAAAATTGAAGAAGAAAAATAAAAGGATCCAGTCATGGGTAGATTTAATATATTTAAAAGAAAAAGGCCTACAAATGTTATAGGTAGAGATGATGATAAAGAAAAAGAAGGATAGGAAAAGCTATAGAAAAAGCTAAAAATTAATCTACCACCCTCAAAACCTCAAAATACAAATTTATTATCATTTCAACAAGATGATGAAGAGGAAGAAGAGTATAATATAGAAGAAAGTGACGAAGACAATAATATTAAAGAAAATGAATGAATGATATTTTATTTAAGAAAAAACA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1933.3 L-2767.6 L-3704.7 S-0475.5 S-3291.9
S-6269.0 S-9291.6 S-12239.4 S-15409.1 S-24548.5
C-0490.7 C-2504.6 C-4385.9 C-61,219.3 C-8872.4
C-101,020.3 C-12496.3 C-14570.5 C-16463.8 C-18356.8