Summary
Transcript IDgene_000023354
Gene IDTTHERM_00538480
Length651 bp
Sequence
AATTAAAAAAAATAAGCGTCTCTCAAGAAAATTAAATAAATTTTAAAATTTTAAAATAGCAACAAAAATAAATGTCAGTAACTTTGCATACTACGCACGGAGAACTAAAAATTGAAGTATTTTGTGAAAAAACTCCAAATGCTGCTAAAAATTTTTTAGCTTTGTGCGCTAGAGGAGATTATAATGGAACAATATTCCATAGAAATATAAAAGGGTTTATTATTTAAGGTGGTGATCCTACTAATACAGGAAAAGGAGGATAAAGTATTTATGGAAAGCCATTTAATGATGAAATTAAAGAAGATATTAAGCATGATAAAAGAGGAATGTTAAGCATGGCTAACTCAGGTCCAAATACTAATTTATCTTAATTTTTTATCCTTTATTCTAAATAAAATCACTTAAATGGATCATATACAATTTTTGGTAAAGTTATTGATGGCTGGGAGGCCTTAGACTTAATGGAAAAAGAACCAATAGATGCAAACGATAGACCACTAAACGAAATAAAAATAAATAAAGTAACAATACACGCAAATCCAATTGCAGACTTCGAAGAATGATTGTAGATATTAAAAAAATATATTTCTTGTTATAATACTTAATTTTTATGTAGAGTTTATAATCAATAAAAAAAACTAAATCTGATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,157.6 L-21,638.1 L-31,077.9 S-01,976.0 S-3792.9
S-61,320.1 S-9801.2 S-12613.2 S-15696.6 S-24709.1
C-0774.0 C-2811.5 C-41,671.9 C-62,176.8 C-81,423.7
C-10858.4 C-12482.4 C-14845.8 C-16769.2 C-18722.1