Summary
Transcript IDgene_000023422
Gene IDTTHERM_00399450
Length471 bp
Sequence
GTTAAAACCTTAAGAATATAAAAAGAGTATCACAAACTCAAAAATATACAATTAAATTTAGTTAAAAAATAGTAAGTAAGTAAATATGTTCAATCCCTTTAGCAGAAAAGATTCAAAAGGAGAAGCCCATCAAAACAGATAAAAAGCAATTGAAAAATTAAGTGTTTTGTAAAATAAGTAAGATGCCTTTATTGCTATAAAAGAATTAGAACATAACTTATATAAGCATTGCTTTAAGAAATGCCTTAAATTAGATGACTAGCTATTTTAAGATGAAGAAAGAGATTGTTTAACAAATTGCAATGCTAAGATTGCTTAATTCCTTTAAATTTCCAAGGATAATTTCTCAAATGTTGAATAAAACATCTAAGTCCTCAAATAAATGGTAAAAGGAAAACCTTCTATTTGAAACCTTTGGACTTAGTTCTCCTTTTGAACTCATTAAAAAAAATTCTTTATATCTAATAAACG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1900.3 L-2720.4 L-3468.2 S-0194.4 S-365.9
S-668.1 S-947.3 S-1258.3 S-1559.6 S-2456.3
C-040.4 C-256.0 C-437.6 C-664.6 C-867.0
C-1063.4 C-1242.3 C-1440.3 C-1639.0 C-1839.7