Summary
Transcript IDgene_000023443
Gene IDTTHERM_00402060
Length1147 bp
Sequence
GGAAAAGTATCTTTTAGGCAAGTAATACATAAACAGAGACACTCATACATACATACAAACAAACAAATAAACTATTGAATTAAGAATGATAATAATAATATTAAATAATTAGTAGATAGAATCTTATACCTAATAAATAGATTAAGCATTAAGTGGCACATTATCAATAAAACATAATAAAAAATATCAATTTTAAACATAACTTCAAACTCATAATTAGCATTATAAGGAGTATTAAACATGGCTGCTACAACTTAAGATTATGGATTAATTGAAAATGCTATTTTGAATAATATTTAGATCATAAAAAATGACTTTATGCTTCTACATTAAAGATAAAAGGGAATGATAAATTAACTTGAGAATGATTTCTTGCAAGCAATCCCAGAGAAAATAAAAAATATGTCAGTTGCTGATTTCTTGTATAAATTTGATGGTGACCTGAATAAAGCCTTTTGCTAACTCTCAGTTGTTGATTTAAATTTAAGTTAAACTCTTTCTAATGCCTCTACCCTTCCATTATAAAATAATACAAATTTTGTTTCAAATAATAATAAGCTAATATATAGTCAAGTATAATCAAGCAGCTTTATGGAGAATTTTCCTAAAAGCAATAACTACAACCCAATAAACTCAAGCAACAGTAAAAGTATTTTGAAAAACTCTAAAAGAAAAAGAAACGAGTACGAATAGAACTAGAAAAAGCTTCTAAATAATCTATATCAGACACACCAAAATAACTATTCCAATAACAAAGAAAACTTTTCACAAAATGGAACATCTCAAATGCACTTCCAGCAGTAATCGAAATAAAATACAGCTAAAAAAAATAATAATACTAACAACAACAATTAAAACTAAAATACTACTTCAAAAAGCGGGAAAAAAATCTGGAAATTTTGAGCTGATTTTCATAAAAGATAAAAATAATCGAACAAATTCTTACTGACTAACACAACTATTTTGTGACTAACTATATATAAAATCAATAAAATGTAAAGTAGAACAATAAATAAATAAATAACTTAACACAAAAAAATTTTTTCTAATAAATTATAATATATTAAAAAAATTAAAATACTATTTTATTTTGATTGTTGTATTAATTAAATATTTATTTTTTCTGATTAGTTTAAAATTATTTCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1241.2 L-2299.0 L-3236.7 S-071.7 S-377.5
S-661.0 S-967.0 S-1267.5 S-1542.9 S-2451.1
C-057.4 C-26,103.6 C-412,044.6 C-613,312.0 C-88,162.7
C-106,638.4 C-123,432.5 C-142,868.2 C-162,015.9 C-181,117.4