Summary
Transcript IDgene_000023534
Gene IDTTHERM_00985160
Length2821 bp
Sequence
AATTAATAAATAAAAAAAAGCAAACTACAAAGAAAATGTCAAGGCGTAACTAAAAAAAGCCATAGGCTCCTATAGGCAATGAAACAAATCTTGATTTTGTATTACAAAATCTAGAAGTTTACAAAAGCCAGATTGAGCATTATAAGACCTAGTAGTAATAGATCAAAGAGGAGGATCTCAAGCTTTTAAAGTTCAAAAATTAAGATTAGGATGGAAACTCTGGCAACGATGATGATGATGAAGAAAACAACTCAAATAAATAATAAGAATTATTAAGGAGAGTCAATTAGATTAAGTAGCAAGTTTAATTGATAAAAAAAGTTGGTTCTAAGGTAGAGAAAGATTTGAATTTGAACGAAGATGAAAACAAAAAGAATGGACTTTCTGAATAGCAAGTGAAAGAAGAGTAATTAAGAACGATTACTGAAGAATAGGTTAAGTATTAAAATTTAGTATTTAACATGGACTACCAGTTAGATTTAAATGAGAGTGGTGGCCATAGAAGACACAGAAGAGAAACAGATTATGATACTGAAAAATGGTTTGAAATATCTCATGACCAAAAAAATTATGTATCAATTTACGCCAACTAAAAGACATCATATTGTTGGTGGCTTAAAGATTATTTTAATAAAAACAATTATGATCATCTTAATGTAAGCATTAACAGACTAGAAACTGAAGCCGAATTCTATGCCTTTGATGATTTTTCACAAACAATCAAACTTACTAATAATTCTTACTAGACTGTTAACATAGACGTTAATTTTGATAATAATCTCTGTATACTCGCATTGCTTAGATTTTTATTATCACTAGAAAGATTCAATATTTTGAATATAAGATCTTCTTATACAAGAAATTAATATAATTTTGAGAAAATTGGTGAGCTACTTGAAACTATCTTCGCAGTTGTCTTTTCTCATCGCCACTTACAAGGCATTCATTTACAAGTTCCTTGCGAAGCGTTCTAATATTTAGTTAACTCCTCATCATAAATTAGCGTTAAAGATAGCTAATTATAGGTATACTCTTTCTCTACAGACTTAAAATTAGTTGACACTAACAAAGTCCAAGATTATTTTAAGTTCTTATAAGAATTCCCTCGTTTGACTCATGTAAGCTAGTAGGCTATCCCAGTTAGTGCTACTAACGCTGTAGAGAACCTCAATGTTTTACTTAAAAAGGTCAAGCATGCTAATCTTAATTTAGTTTCTATCCCTACCTAATTCAATTTTGATTTCTACTTTGTTAATTTATAACATTTGAAATTAGAGTTTGGATTAGAACCAAATATTTTGACAAAACAAAAGCTTGAAAATCTACTTTTGAGTATAAAATAATCAAAAAATCTTAAATTTTTAAGATTAAACTTTTACACCTACGTTGCTTAAGAAACCTCCAGAAAACAGATATTAAAACAAGCTACAACAATCAAAAATCTCAAAAACAATAAAAATCAAGAAGAAACTCCTGAAACTAAAGATGAAACTCCAAGCGAAAGCACAAGTGGTATGAAATTTTTTGATCATCTTTCTGAATTAACCGAGCTTGAAGATTTCAGCGTTAACTTGTAAGCTACCCAAGAAATTTATGATAGCTTGCACAAACTTTTGATTAGATCAACAAATTTAAAGAAGTTCAAATTAAGTTACAAATATGAAATGGAAAAGAGTAAAATGGATACATTCATAGATCTTAAGAATATTTATGAAACCTTAAACAATCTTAAAAGATGCTCTGTTAATATATCAAATCCTCATGGAAACATTTCTTATGAACTGACAAATAAAGATTCTACTTTTTATAAATTTAAGCTGACCTTAAACTAAGAATTATAACACGCTAAGTATACTTTTAAGTAGAACGAATTTTAATTTAATAACGTTAAAAGTGCAAAAATTGAATCTTCCTCATTAGAAAGCTTAGAAGATATTGATAGTCTTTGCAAATCTATTGCTTCTTGTAAAAATTTACAAAATGTTAATATTATCGCCAGTTTGCTCTATCCCAACAATATTTAGAAAAATCCTTTCAATAAGCCCAATCTTCTATTTTTCAAGCAATTTGAATAATTGAAAAATTTGGAAAATGTATCTATCAACTGTATTCTTGATCAGCATATACTTAATTCTATTTCAGAATTCTTAGAAAAGAATAAAAAAATAAAAGCATTCATTTTGAAAAGATATTATTTATTACAATATTATCTTGATTATACTAAATTATTTAAAACACTTCAATAGTTACCTGAATTAAATTAAGTTTACATTAATTAGCAATTAGAAGAATTGACTGTGAGTGAAGTACATAAGTAAGTATGGGAAAACCACAAGCAAAAAGCTTTCTATGAACCATTATGTGAGTTTATCAAAGAATCATCCTAAACCCTTTAGCTAATAGATTTTGACCAAAACACTGTAAGTGATGACTCTATTAAAAAGATTTTAGAATCTATATCTGAGTCTAAGTATCATCATTATTTGAGATTGAACCCTAGTTAATCTAGCAGTTTAATTAAATCTGAAAACGAAGAAATTTAAGAACTTCTCAAAGCTTGCGACGAAAAAGGTGTTTTAGTAAAAGCATACTATAAATTCCCTCTATGTTTACCAACTGGTACTTATTACGATTACAATTCAGATAGATGGTGATTAATTAAATATTAGTTTAAATAAATATTAAATATTGAATATTTCTTTGCTTATTATTTGAATAATACATACAATAGTCATTTTTAGTGTTTTGAATATATTTTAGTTATTTAATTCATTATTTTAAGTAAATAATTATTTTTCAATCATTTTTTAAAAAATCAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,867.9 L-22,819.9 L-32,599.2 S-0778.6 S-32,112.3
S-61,065.3 S-9992.5 S-121,077.2 S-151,232.9 S-241,222.6
C-01,164.1 C-22,245.0 C-4864.4 C-6562.2 C-8832.4
C-101,232.9 C-121,134.4 C-141,544.5 C-161,838.4 C-181,818.5