Summary
Transcript IDgene_000023602
Gene IDTTHERM_00486640
Length868 bp
Sequence
AACTAAAGCAAAATTAGGAATCACAAGACTTATCTTAGCTAATAGATCTACTAGATAGTATCTAGAAATTGAGCTTATAAAGTGCAAATTTACTTGATCCATTTTAATAAAGTGTCATAGACTCTCTAAAAAAAATTAAGGAAGCAGAATTAGCTATTAAAAAAAAGAATGATGTGTTTGACTTACCTAGTTTAGTCTACAATTAAAAAATTGATGCTAGAATTGTAAATAACCTATTCATAGAATTCTAAAATTAGGACAAAAATGATGTATTTAGACTAATATTTACTTCATTTGCTTTGAATTTACCTTTTGATTCGATATAAGATGACTCACCCTTCAATTCATAAAATATGAATGAAAAGTTAGAATATGTGGAATAGATTTTATTCTAAAAAGAACCTATTAAAATTTAAATAGAAGATAAATTTATTACATCAGAACAAGCTAAATAAGTTGTAATGTAAATAATTAGAGAGCTAGCTTAAGAATCTAAAACCAAAAACTTTTTGTCATTATGCTATAGCTTGATAAAAAAGATCTAAAATAAAATCAATGATTTGTGTGTAGTAGCTCTAATGAGATCAATTATTTTTAACGCAAAAGAAGATAGCACGCCTCCTTATCTTGAACTATTGGATATTTTTTCTGAACTTAATTCTAAACCTTGTATTTAGGATTAGAAAGAATTTTGGTGGAAAGTGTGTAATGCTTTTTCCTGTTATATTTATTTAGGATAAGAAAACTAAAGTCCTAAGAAATTAGGATATCCTGCAATTCCTGATGGATAACTTTAACTCCCAGATATGTTACTAATTAAGTAAAATAATTAATTGAAATACATAATTAATGAGAATTTCAAACCTGT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1551.2 L-2331.5 L-3270.8 S-065.9 S-3432.1
S-6723.3 S-9701.4 S-12246.9 S-15171.8 S-24187.5
C-0194.4 C-2263.4 C-4529.3 C-6167.3 C-859.9
C-1047.6 C-1239.5 C-1447.0 C-1670.5 C-18121.7