Summary
Transcript IDgene_000023604
Gene IDTTHERM_00486660
Length948 bp
Sequence
TTAAAAGCGAATTTAAACACACAAAAGAATAAGATATTTATAATCTCTTTAAATGGAAAATATTTAAATTAGAGAAGACCTAAAATAATCTGTCCTTAAGTTTGTTATCCAAGATGTAGAGAGTAAATATAATGTAAAAGTTTTATTTTGCGCAGAGACTGGAAGCAGAGGATATCATACTCATACATCTCAATCTGATTTAGACGTAAAGGGCTTTTATGCTAGTAAAACAGAAGATTATTTGATAACTAATGATAAAAAGAAAATCTTATAAAAGACTCATCACTTTCTTAAATTAGAAGATGGGTCTGAAGTTGAATTTGATTATACTTTCCTTGATATAAGAAAATTTTTGAAAAGAAAGCTTAGACCAAACAAAATAGATTAAATGAACTTATGGGTTATGAGTGAAAGCGTCTACTTGAATAAATTTGATGAAGATACACTAAAGTTTTTTTAGAAAGAGCTTAAGCTGCCATATACAGCATTAAATGGTCACATGAAAACATATTTAAAAATATTTTCAAAATAAAATCCAACATTAAAAGTAAAAGAAATACTTACTTCTATTATAGTTGGTTTCTAACTCTTACACATGATAATATTTAAGGAAAATCCTATTTATTAGACTTGGAAATAGTAGAATTATTTAAAGAAATATGTTGATAATTTAAGGGATTAGAGTAAAGAAGTACCTTTGCCATTAAAAAATATTGAGCATATTTAAAAATATGCCTTAGAACTCTATGAACTTAAAAAAGAAGCACGTAAGGGAGAGTTGGAAAATATTGACTCATCCTTTTTAGAATGGATGCAATAAGTTATAAATTTTTATAAAGATTTTTAAGAATAAACTTTGAGTTAGGATTACAGTGAAAGCCCTGAAATTTCTAAAAGTAGAGCAGATCAAATATTTTAAAAAATGAGAAAGATTGCAGATGAAAATTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1405.8 L-2420.6 L-3299.0 S-0452.9 S-3449.5
S-6386.7 S-9313.1 S-12238.0 S-15274.4 S-24187.1
C-0142.0 C-2135.9 C-4147.2 C-6205.8 C-8153.4
C-10189.7 C-12145.3 C-14200.0 C-16162.2 C-18188.9