Summary
Transcript IDgene_000023674
Gene IDTTHERM_00974260
Length531 bp
Sequence
GATTACTTGTGCATATTTTTGGTTTATTACAGGATCTTTAAAAACTAATTCTCTAGAGGATTTTTCCCTTTGAGTGTTATAAGTAGGATCAGTAAAAAAGAATGGGTAAGAACTAAGATCTTCATATTTTCTAATTCTGTTAGTTACTATTTCTATAATCTGCACTATGTTTTTATCTTTAACTCTGTCTATAGCTTCCTAGAAGTCAGGGCCTAATTGCTAAATGAGAATTTCCCTAAATTCATTGATAAGCTTATCACTTTATTTTTAACTAATATCGTCTCCAAAAAGAGGCATATATTTTTGGCGTATGAAGTATCTATTGAAGTAATTCAATTTTAGCTAGTCATATTCAAAGCTTTCTTGTTTAACATCTTGCATAGTGAAGCTATTCATGAGATATTCAGGTGAGTATAATTCAAGGGCATATATTTCATCTTAAGTTTTACCTTCTTCTTTGAGTTACTTGATTTTTTAATTGACAACCTAGTTTCTCCATATTTAGGTAATGACAAAGTTAGCTAAAGCTTG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1991.1 L-2499.7 L-3236.7 S-0102.3 S-378.5
S-6120.1 S-9117.3 S-12128.1 S-1566.8 S-24113.3
C-0312.3 C-2128.0 C-468.9 C-654.7 C-885.2
C-1093.6 C-12116.6 C-1493.3 C-1663.2 C-1877.7